Search

CN-121992145-A - InDel molecular marker closely linked with corn female spike cluster generation/single-growth trait main effect QTL locus qCE1 and application

CN121992145ACN 121992145 ACN121992145 ACN 121992145ACN-121992145-A

Abstract

The invention belongs to the technical fields of corn genetic breeding and molecular biology, and particularly relates to an InDel molecular marker closely linked with a corn female spike cluster/single-growth trait main effect QTL locus qCE and application thereof. The main effect QTL locus qCE is located on chromosome 1 of the maize Zm-B73-REFERENCE-NAM-5.0 REFERENCE genome, the marker interval is Chr.01_23431188-23431982, and the region corresponding to the Gt1 gene upstream 2611-1817 bp is provided. InDel molecular markers developed based on qCE different haplotypes have remarkable effect in identifying corn female cluster growth/monosity, can be used for auxiliary breeding of corn female cluster growth/monosity related molecular markers, and accelerates the breeding process.

Inventors

  • WANG LIWEI
  • WANG JIANGHAO
  • SONG LIANG
  • LI XINGHUA
  • WEI JIANFENG
  • GUO RUI
  • SONG WEI
  • YAN YUANYUAN

Assignees

  • 河北省农林科学院粮油作物研究所

Dates

Publication Date
20260508
Application Date
20260403

Claims (8)

  1. 1. An InDel molecular marker closely linked with a main effect QTL locus qCE1 of maize female spike cluster/single-growth trait is characterized in that the main effect QTL locus qCE is positioned on chromosome 1 of a maize Zm-B73-REFERENCE-NAM-5.0 REFERENCE genome, a marker interval is Chu.01-23431188-23431982 and corresponds to a Gt1 gene upstream 2611-1817 bp region, the InDel molecular marker comprises a main molecular marker, the main molecular marker consists of qCE-del F and qCE1-del R1, the position of qCE-del F is Chu.01: 23430548-23430570, and the position of qCE1-del R1 is Chu.01: 23432472-23432493.
  2. 2. The InDel molecular marker according to claim 1, wherein the InDel molecular marker further comprises a co-molecular marker consisting of qCE-del F and qCE-del R2, the qCE1-del R2 being located at chr.01:23431554-23431573.
  3. 3. A primer combination for detecting the InDel molecular marker according to claim 1, characterized by comprising a forward primer qCE-del F and a first reverse primer qCE-del R1; forward primer qCE-del F TTATCAAACATCACACGAGAGAA; first reverse primer qCE-del R1: ACCATTCAGGTCCAAACATTAC.
  4. 4. A primer combination for detecting the InDel molecular marker according to claim 2, characterized by comprising a forward primer qCE-del F and a second reverse primer qCE-del R2; forward primer qCE-del F TTATCAAACATCACACGAGAGAA; The second reverse primer qCE-del R2: CGAGCTGAGTGAAGTTGTAC.
  5. 5. A method for identifying a maize female scion/monospecific trait comprising the steps of: (1) Extracting genome DNA of a corn sample to be detected; (2) Performing PCR amplification using the primer combination of claim 3 or 4 using the genomic DNA as a template; (3) Gel electrophoresis is carried out on the amplified product; (4) Judging results; wherein, when PCR amplification is performed using the primer set of claim 3, if the size of the amplified product is 1833 bp or 1138 bp, it is determined that the female spike is clustered, and if the size of the amplified product is 1946 bp, it is determined that the female spike is single; When PCR amplification is performed using the primer set according to claim 4, if the amplification product size is 910 bp or 0 bp, it is determined that the female ear is clustered, and if the amplification product size is 1026 bp, it is determined that the female ear is parthenogenic.
  6. 6. Use of the InDel molecular markers of claim 1 or 2 or the primer combinations of claim 3 or 4 in any of the following applications: (1) Identifying or assisting in screening maize female ear cluster growth/single growth traits; (2) Corn molecular marker assisted breeding; (3) Preparing detection products for identifying corn female spike cluster generation/single growth characteristics; (4) And (5) preparing corn breeding related products.
  7. 7. A corn female cluster/monospecific auxiliary breeding kit is characterized by comprising the primer combination as claimed in claim 3 or 4 or an equivalent molecular marker primer redesigned based on the sequence variation in the interval chr.01_ 23431188-23431982.
  8. 8. A corn breeding method is characterized in that the detection method of claim 5 is adopted to detect qCE haplotypes of corn materials, corn materials with female ears clustered/single-grown are screened as parents for cross breeding, and female ear clustered/single-grown corn germplasm or variety is cultivated.

Description

InDel molecular marker closely linked with corn female spike cluster generation/single-growth trait main effect QTL locus qCE1 and application Technical Field The invention belongs to the technical fields of corn genetic breeding and molecular biology, and particularly relates to an InDel molecular marker closely linked with a corn female spike cluster/single-growth trait main effect QTL locus qCE and application thereof. Background Corn is one of the main food crops in the world, and has a vital effect on the development of related industries such as global food safety, feed, fiber, fuel and the like. In recent years, the market demand of China on corn has a trend of increasing year by year under the influence of multiple factors such as dietary structure transformation and upgrading, fossil fuel reserves reduction, ecological environment continuous deterioration and the like. Meanwhile, the current corn unit yield level reaches the growing bottleneck, breakthrough promotion is difficult to realize in a short period, and in addition, extreme natural disasters such as high temperature, drought, waterlogging, strong wind, hail and the like in each domestic large corn ecological area frequently occur, so that a series of production problems such as corn female ear dysplasia, plant lodging, rust spreading, meadow moth outbreak and the like are further caused, and the safe production of corn is seriously threatened. Under the triple contradiction of single-yield bottleneck, environmental stress and demand rising, the corn environmental adaptability is improved, the yield loss is reduced, and the corn yield-improving agent becomes a key path for guaranteeing stable and high yield of corn and maintaining industry stability. Corn is acclimatized by the combination of the euteosinte and the plateau euteosinte, plant morphology is remarkably evolved in the long-term acclimation process, the characteristics of female ears are gradually evolved from not less than 100 cluster-growing young female ears per plant of the euteosinte to 1-2 single-growth large female ears per plant of modern corn, the variation not only improves the corn harvesting convenience, but also optimizes the single plant and population yield, but the acclimation process of female ears from cluster growth to single growth is not thorough, and the cluster-growing characteristics of female ears are still commonly reserved in a large number of inbred lines, hybrid varieties and local varieties of the modern corn (figure 1; Yang N, Wang Y, Liu X, Jin M, Vallebueno-Estrada M, Calfee E, Chen L, Dileks BP, Gui S, Fan X, Harper TK, Kennett DJ, Li W, Lu Y, Ding J, Chen Z, Luo J, Manbakkam S, Menon M, Snodgrass S, Veller C, Wu S, Wu S, Zhuo L, Xiao Y, Yang X, Stitzer MC, Runcie D, Yan J, Ross-Ibarra J (2023) Two teosintes made modern maize. Science 382: eadg8940;Urano D, Jackson D, Jones AM (2015) A G protein alpha null mutation confers prolificacy potential in maize. Journal of Experimental Botany, 66: 4511-4515）. The cluster-forming ears formed by cluster formation of the female ears in modern corn are called banana ears, baby ears or finger ears in China, are called bouquet ears, monkey hands or multiple ears syndrome (Multiple Ears on A SINGLE EAR SHANK, MESS) in China, are specifically characterized in that secondary female ears are germinated at the internode positions of the top female ears of corn, the internode positions of the secondary female ears can be further differentiated to form new secondary female ears, a plurality of secondary female ears are clustered around the top female ears, the number of female ears in each cluster is 2-6, partial plants can even reach 10, the secondary female ears are basically abnormal and can compete for nutrients, moisture and photosynthetic products with the top female ears, and finally, the corn seed yield and quality are greatly reduced (figures 1 and 2). The female spike cluster growth trait is regulated and controlled by the genetic characteristics of corn germplasm and external environmental conditions, and the susceptible germplasm carrying the cluster growth trait can stably show female spike cluster growth phenotype under different environmental conditions, and meanwhile, the occurrence rate and the aggravation degree of cluster growth can be further improved due to adverse stress such as high temperature, drought, overcast and rainy oligose (figure 2). In recent years, under the influence of high-temperature weather normalization, female cluster growth traits are shown in more and more main varieties of corns, and even a main variety such as Zhengdan 958 also has the traits, and a new variety display area of 2020-2021 Chinese seed university held three times in Hainan and south-numerous silicon valley forum is shown in 3 months of 2021, wherein 213 corn hybrids (combinations) are totally displayed, 55 fresh corn hybrids (combinations) and 158 seed corn hybrids (combinations) are researched, 22 fresh cor