Search

CN-121992152-A - Rapid detection primer set for shrimp iridovirus based on RPA-CRISPR/Cas12a system, application and kit

CN121992152ACN 121992152 ACN121992152 ACN 121992152ACN-121992152-A

Abstract

The invention relates to the technical field of gene detection, in particular to a shrimp iridovirus rapid detection primer group based on an RPA-CRISPR/Cas12a system, application and a kit. The primer group is an iridovirus isothermal gene amplification primer and a specific recognition amplification product target sequence probe, wherein the iridovirus isothermal gene amplification primer, the specific recognition amplification product target sequence CRISPR probe and the ssDNA report probe are described in the specification. According to the invention, isothermal amplification primers and CrRNA are designed based on the shrimp red virus genes, target genes are amplified through isothermal amplification technology, crRNA is used for guiding Cas12a to accurately identify and activate trans-cutting, a test strip report probe is synchronously cracked, and a visual advantage of an immune test strip is relied on, so that a result is visually read in 30min. The whole process does not need large instruments, has simplified operation and low cost, and provides an intuitive and efficient solution for on-site rapid diagnosis.

Inventors

  • WANG RUI
  • QIU TIANLONG
  • CHI LIANG
  • WANG YANFENG
  • XU JIANPING
  • TIAN HUIQIN

Assignees

  • 中国科学院海洋研究所
  • 青岛农业大学

Dates

Publication Date
20260508
Application Date
20260211

Claims (8)

  1. 1. A rapid detection primer set for shrimp iridovirus based on an RPA-CRISPR/Cas12a system is characterized in that the primer set is an iridovirus isothermal gene amplification primer and a specific recognition amplification product target sequence probe, wherein the iridovirus isothermal gene amplification primer is as follows: DRPA1-F:5’-TATTTTCTAGATCAGGCCAGTTTTGTATTCG-3’ (SEQ ID No.1) DRPA1-R:5’-ATTTCGTCAGCATTTGGTTCATCCATGACTGC-3’ (SEQ ID No.2) CRISPR probes specifically recognizing the amplified product target sequence: crRNA: UAAUUUCUACUAAGUGUAGAUCCCGUAAUCAGAGAUGUGUU(SEQ ID No.3); 5'-FAM-NNNNNNNNNN-3' -Biotin.
  2. 2. The method of claim 1, wherein the primer set is used for detecting prawn iridovirus based on RPA-CRISPR/Cas12a system.
  3. 3. A kit for rapidly detecting shrimp iridovirus is characterized in that the kit comprises the primer set of claim 1.
  4. 4. The kit for rapidly detecting shrimp iridovirus according to claim 3, wherein the kit is a isothermal amplification system, a CRISPR/Cas12a system and an immune test strip, wherein the isothermal amplification system is a isothermal amplification system reagent and an iridovirus isothermal gene amplification primer, and the CRISPR/Cas12a system is a CRISPR/Cas12a system reagent, a isothermal amplification product and a specific recognition amplification product target sequence CRISPR probe.
  5. 5. The kit for rapidly detecting shrimp iridovirus according to claim 4, wherein the immunochromatographic test strip is composed of a sample pad, a binding pad, an NC film detection pad with a backing and an absorption pad which are laminated on a transparent adhesive plate, wherein the binding pad contains gold-labeled antibodies and gold-labeled streptavidin, a detection line (T line) and a quality control line (C line) are arranged on the NC film, the T line is fixed with anti-FAM/FITC antibodies and used for capturing complete report probes which are not cut off by CRISPR-Cas, and the C line contains anti-gold-labeled antibodies and used for collecting redundant gold-labeled complexes to verify the effectiveness of the test strip.
  6. 6. The kit for rapidly detecting shrimp iridovirus according to claim 5, wherein the immunochromatographic test strip detection result analysis method is a line elimination method, T, C lines are negative in color development result, only C line is positive in color development result, and C line is not developed or C line and T line are not developed, so that the test strip fails.
  7. 7. A method for using the kit in rapid detection of shrimp iridovirus according to claim 3, characterized in that a sample to be detected is amplified by using a isothermal amplification system reagent shrimp iridovirus genes to obtain an amplified product with PAM sites; Co-incubating the Cas12a protein with amplification products carrying PAM sites and corresponding crRNAs to form Cas12 a-crRNA-target gene ternary complexes, and activating gene probes in a cleavage reaction system by the complexes; And (3) reacting the reaction product with an immune test strip, and obtaining whether the sample contains the shrimp iridovirus through the chromogenic reaction of the test strip.
  8. 8. The use of the primer pair of claim 1 or the kit of claim 3 in diagnosis of shrimp iridovirus infection or prevention and control of farm epidemic disease.

Description

Rapid detection primer set for shrimp iridovirus based on RPA-CRISPR/Cas12a system, application and kit Technical Field The invention relates to the technical field of gene detection, in particular to a shrimp iridovirus rapid detection primer group based on an RPA-CRISPR/Cas12a system, application and a kit. Background Shrimp iridovirus (SHRIMP IRIDESCENT Virus, SHIV) is a large double-stranded DNA Virus, belongs to iridoviridae, and is one of the important pathogens that endanger the global shrimp farming industry. The virus has the characteristics of wide host range, strong infectivity and high death rate, can infect various economic prawn varieties, has the death rate of 50-100% of the disease-causing prawn group, and causes huge economic loss for the aquaculture industry. At present, the detection method of the shrimp iridovirus mainly comprises a virus separation culture method, a PCR method and fluorescence quantification. However, the methods have certain limitations, the virus separation culture method has complicated operation and long culture period, and has strict requirements on laboratory conditions, and the requirements on rapid detection are difficult to meet, and the conventional PCR method and the real-time fluorescence quantitative PCR method have higher specificity and sensitivity, but need large-scale precise instruments such as a PCR instrument, a fluorescence quantitative PCR instrument and the like, require professional technical staff to operate, have high detection cost, and cannot be popularized and applied in the scene of lack of professional equipment such as a culture site, a basic detection point and the like. In recent years, a detection technology of combining a recombinase polymerase amplification technology (RPA) with CRISPR/Cas12a is taken as a novel nucleic acid detection platform, although the technology platform has been reported in other virus detection, the detection performance of the technology platform is highly dependent on primers designed for specific targets and crRNA due to significant differences among genome sequences, conserved regions and optimal targets of different viruses. The genome of the penaeus vannamei iridovirus (SHIV) belongs to an independent evolution branch of the iridoviridae family, wherein the GC content is only 34.6%, which is significantly lower than the ideal range of 40-60% adopted in the optimization of the conventional RPA-Cas12a system, and the low GC content characteristic may lead to the decrease of the RPA amplification efficiency. In addition, the core conserved gene of the penaeus vannamei iridovirus (SHIV) has homology of less than 50% with the known iridovirus members, and has sequence similarity of 99% with the similar red swamp crayfish iridovirus (CQIV), but the host tissue affinities of the two are quite different, and the problem of insufficient sensitivity can occur due to unmatched viral load and detection signals in a sample when the target is directly multiplexed with CQIV. Therefore, the shrimp iridovirus detection technology which is simple and convenient to operate, quick and sensitive, does not need a large instrument and has visual results is developed aiming at shrimp iridovirus genes, and has important significance for realizing early warning, timely prevention and control of viruses and guaranteeing healthy development of aquaculture industry. Disclosure of Invention The invention aims to provide a rapid detection primer set for shrimp iridovirus based on an RPA-CRISPR/Cas12a system, and application and a kit thereof. In order to achieve the above purpose, the invention adopts the technical scheme that: The rapid detection primer set for the shrimp iridovirus based on the RPA-CRISPR/Cas12a system comprises an iridovirus isothermal gene amplification primer and a specific recognition amplification product target sequence probe, wherein the iridovirus isothermal gene amplification primer comprises the following components: DRPA1-F:5’-TATTTTCTAGATCAGGCCAGTTTTGTATTCG-3’ (SEQ ID No.1) DRPA1-R:5’-ATTTCGTCAGCATTTGGTTCATCCATGACTGC-3’ (SEQ ID No.2) CRISPR probes specifically recognizing the amplified product target sequence: crRNA: UAAUUUCUACUAAGUGUAGAUCCCGUAAUCAGAGAUGUGUU(SEQ ID No.3); 5'-FAM-NNNNNNNNNN-3' -Biotin. The application of the primer group in the detection of the prawn iridovirus based on the RPA-CRISPR/Cas12a system. A kit for rapidly detecting shrimp iridovirus comprises the primer group. The kit is a isothermal amplification system, a CRISPR/Cas12a system and an immune test strip, wherein the isothermal amplification system is a isothermal amplification system reagent and an iridovirus isothermal gene amplification primer, and the CRISPR/Cas12a system is a CRISPR/Cas12a system reagent, a isothermal amplification product and a CRISPR probe for specifically identifying an amplification product target sequence. The isothermal amplification method of the isothermal amplification system reagent is any one of