Search

CN-121992155-A - RT-LAMP and immunochromatography combined porcine epidemic diarrhea virus nucleic acid detection kit and application thereof

CN121992155ACN 121992155 ACN121992155 ACN 121992155ACN-121992155-A

Abstract

The invention belongs to the technical field of molecular biology detection, and particularly relates to a Porcine Epidemic Diarrhea Virus (PEDV) nucleic acid detection kit combining RT-LAMP and immunochromatography and application thereof. The kit combines the advantages of high sensitivity and high specificity of the loop-mediated isothermal amplification technology and the rapid and visual interpretation of the immunochromatographic test strip, and realizes the on-site, rapid and accurate detection of PEDV. The core of the invention comprises a set of specific primer set designed for the PEDV N gene conservation region, an optimized RT-LAMP reaction system and an immunochromatography test strip which is used for detecting LAMP amplification products after special treatment. The kit does not need an expensive thermal cycler, the whole detection process is completed in 40min, the sensitivity can reach 100 copies/mu L, and the kit is particularly suitable for rapid diagnosis and epidemic prevention and control in the fields of pig farms, basic-level veterinary stations and the like.

Inventors

  • XIONG TING
  • TAN ZHIQING
  • CHEN RUIAI
  • LI HONGMEI
  • JING MENGYAO
  • LIANG JIANHUA

Assignees

  • 岭南现代农业科学与技术广东省实验室肇庆分中心

Dates

Publication Date
20260508
Application Date
20260402

Claims (10)

  1. 1. A primer set for RT-LAMP detection of PEDV, comprising an outer primer pair comprising an outer forward primer and an outer reverse primer, an inner primer pair comprising an inner forward primer and an inner reverse primer, and a loop primer pair comprising a loop forward primer and a loop reverse primer, characterized by the following sequences: an external forward primer ACAGCGGCAAAAATACACCT; an external reverse primer AACTGGCGATCTGAGCATAG; an internal forward primer CGCCCTTGGGAATTCTCCTCCGGCCACTTCGAAGGAACG; an inner reverse primer GCAGCTTGCTTCGGACCCAGCCTGACGCATCAACACCTT; A loop forward primer ACTCTGGGATGTCTTTGAGGTCA; Loop reverse primer AAACTTTGGAGATGCGGAATTTGTC.
  2. 2. An RT-LAMP reaction system for detecting PEDV, comprising the primer set of claim 1, preferably wherein the 5 'end of the loop forward primer is labeled with a first label and the 5' end of the inner forward primer is labeled with a second label, wherein the first label is different from the second label.
  3. 3. The RT-LAMP reaction system of claim 2, further comprising 10 x LAMP Buffer, magnesium sulfate, dntps, DNA polymerase and a nucleic acid sample to be tested.
  4. 4. The RT-LAMP reaction system according to claim 3, wherein the amount of 10 XLAP Buffer is about 2.5. Mu.L; and/or a magnesium sulfate concentration of 10 mM-13 mM; And/or dNTP concentration of 1 mM-1.4 mM; and/or the concentration of the external forward primer and the external reverse primer is 0.2 mM-0.6mM, respectively; And/or the concentration of the inner forward primer and the inner reverse primer is 2 mM-4 mM, respectively; And/or the concentration of the loop primer is 0.2 mM-0.6 mM, respectively; and/or the addition amount of the DNA polymerase is 4U 16 U。
  5. 5. The immunochromatographic test strip for detecting PEDV is characterized by comprising a sample pad, an interpretation area, a combination pad and a water absorption pad, wherein the sample pad, the combination pad, the interpretation area and the water absorption pad are sequentially overlapped; Binding molecules 1 which are specifically bound with a first marker on a loop forward primer in an RT-LAMP reaction system are coated in the detection line; the quality control line is coated with a quality control antibody which specifically binds with the binding molecule 2 in the binding pad; The binding pad is marked with a binding molecule 2 marked by colloidal gold, and the binding molecule 2 marked by colloidal gold is specifically combined with a second marker on an internal forward primer of RT-LAMP reaction, wherein the binding molecule 2 marked by colloidal gold is marked to the binding pad after being dissolved by a treatment solution A, and the treatment solution A comprises a synthetic high molecular substance 1, saccharides, buffer solution, bovine Serum Albumin (BSA) and Sodium Dodecyl Sulfate (SDS); The sample pad is obtained by immersing a sample pad base material in a treatment liquid B, and then drying, wherein the treatment liquid B comprises a synthetic polymer substance 2, saccharides, a Phosphate Buffer (PB), BSA, a preservative and a surfactant, or the treatment liquid B comprises a buffer, BSA, a surfactant, a preservative and NaCl.
  6. 6. The immunochromatographic test strip according to claim 5, wherein the synthetic polymer substance 1 comprises at least one of polyvinylpyrrolidone (PVP) and polyethylene glycol 8000 (PEG 8000); and/or the synthetic polymer substance 2 comprises at least one of polyvinyl alcohol (PVA), PVP and PEG 8000; And/or the saccharide comprises at least one of sucrose and trehalose; And/or the buffer solution comprises at least one of Tris-HCl buffer solution, HEPE buffer solution, PB buffer solution and phosphate buffer solution; And/or, the preservative comprises at least one of NaN 3 , proclin 300; and/or the surfactant comprises at least one of Tween 20, triton and NP-40.
  7. 7. The immunochromatographic test strip according to claim 5 or 6, wherein in the treatment solution A, the mass percentage of the synthetic polymer substance 1 is about 0.5%, the mass percentage of the saccharide is about 2%, the concentration of the buffer solution is about 0.02 mM%, the volume percentage of the BSA is about 0.2%, and the mass percentage of the SDS is about 0.04%; And/or in treatment solution B, the mass percentage of the synthetic polymer 2 is about 2%, the mass percentage of the saccharide is about 1%, the concentration of the buffer solution is about 0.1M, the volume percentage of the preservative is about 0.03%, the volume percentage of the surfactant is about 0.05%, or in treatment solution B, the concentration of the buffer solution is about 50mM, the volume percentage of the BSA is about 2%, the volume percentage of the surfactant is about 0.5%, the mass percentage of the preservative is about 0.05%, and the mass percentage of NaCl is about 1%.
  8. 8. Kit for detecting PEDV, characterized by comprising the primer set according to claim 1, the RT-LAMP reaction system according to any one of claims 2 to 4, and/or the immunochromatographic test strip according to any one of claims 5 to 7, preferably, the kit further comprises a standard positive plasmid as a standard positive control, the standard positive plasmid being a plasmid containing PEDV N gene of porcine epidemic diarrhea virus.
  9. 9. Use of the primer set according to claim 1, the RT-LAMP reaction system according to any one of claims 2-4, and/or the immunochromatographic test strip according to any one of claims 5-7 in the preparation of a kit for detecting PEDV virus and/or porcine epidemic diarrhea.
  10. 10. The use according to claim 9, characterized in that it comprises: s1, taking nucleic acid of a sample to be detected as an amplification template, and performing amplification reaction by using the primer set according to claim 1 or the RT-LAMP reaction system according to any one of claims 2-4 to obtain a product; s2, diluting the product in the step S1 by using a diluent; s3, detecting the diluted product obtained in the step S2 by using the immunochromatographic test strip according to any one of claims 5 to 7, and observing the result; The judgment standard of the result of the step S3 is as follows: ① Positive, namely, two color bands appear on a quality control line and a detection line T, and the sample to be detected is shown to be PEDV positive; ② The negative is that only one color band appears on the quality control line, which indicates that the sample to be tested is PEDV negative; ③ And (3) invalidating, namely, no color band is generated in the quality control area and the detection line or only the detection line generates color bands, and indicating that the test paper strip is invalid.

Description

RT-LAMP and immunochromatography combined porcine epidemic diarrhea virus nucleic acid detection kit and application thereof Technical Field The invention belongs to the technical field of molecular biology detection, and particularly relates to a kit for detecting porcine epidemic diarrhea virus nucleic acid by combining RT-LAMP and immunochromatography and application thereof. Background Porcine Epidemic Diarrhea Virus (PEDV) can cause Porcine epidemic diarrhea, which is manifested as diarrhea, vomiting, dehydration and the like, and is one of important pathogens causing diarrhea and death of piglets, and pigs in other stages can continuously carry poison after infection, thus causing serious economic loss to pig industry around the world. At present, the main prevention and control measures for PEDV are an inactivated vaccine and a low-virulent vaccine for immunized sow, so that the sow generates a maternal antibody so as to protect piglets. Therefore, detection of anti-PEDV antibodies in sow milk, blood, and piglet blood is an effective means of diagnosing infection or evaluating vaccine immunogenicity. At present, the detection method for PEDV mainly comprises virus separation and identification, which is regarded as a 'gold standard', but takes a long time (days to weeks), has high technical requirements and is not suitable for rapid diagnosis. The ELISA is mainly used for detecting antibodies, is easy to leak detection in early window period of infection, and cannot distinguish vaccine toxin from wild toxin. Reverse transcription-polymerase chain reaction has high sensitivity, but relies on precise and expensive PCR instruments and gel electrophoresis equipment, has complex operation, has the risk of aerosol pollution, and is difficult to popularize in a basic layer. Real-time fluorescent quantitative RTPCR has high sensitivity and quantification, but the equipment is expensive, has high requirements on operators, and is also not suitable for on-site rapid detection. The loop-mediated isothermal amplification technology is a novel nucleic acid amplification technology, and can realize exponential amplification of target genes in a short time (15-60 min) through DNA polymerase with strand displacement activity at a constant temperature (about 60-65 ℃). Meanwhile, BST enzyme used in the LAMP technology has amplification activity and reverse transcription activity, so that RNA and DNA samples can be amplified simultaneously. The LAMP technology has the advantages of low equipment requirement (only needed by a water bath or a metal bath), high sensitivity, strong specificity and the like. However, the conventional LAMP result interpretation depends on turbidity observation, fluorescent dye or gel electrophoresis and other product analysis methods, and the steps are complicated. Therefore, there is an urgent need in the art for a solution that combines the high efficiency of RT-LAMP technology with an intuitive detection method that does not require complex equipment to achieve a truly rapid and accurate diagnosis of PEDV on site. Disclosure of Invention Aiming at the defects of the prior art, the invention aims to provide the PEDV detection kit which is simple and convenient to operate, quick, sensitive, specific and suitable for on-site use, and has simple preparation process and low manufacturing cost. The kit perfectly solves the problems of high dependence on equipment, complicated operation steps, inconvenient interpretation and the like of the traditional method by combining RT-LAMP amplification with colloidal gold test strip detection. In this regard, the present invention includes, but is not limited to, the following technical solutions: In some embodiments, the invention provides a primer set for RT-LAMP detection of PEDV, comprising an outer primer pair comprising an outer forward primer and an outer reverse primer, an inner primer pair comprising an inner forward primer and an inner reverse primer, and a loop primer pair comprising a loop forward primer and a loop reverse primer, characterized by the following sequences: an external forward primer ACAGCGGCAAAAATACACCT; an external reverse primer AACTGGCGATCTGAGCATAG; an internal forward primer CGCCCTTGGGAATTCTCCTCCGGCCACTTCGAAGGAACG; an inner reverse primer GCAGCTTGCTTCGGACCCAGCCTGACGCATCAACACCTT; A loop forward primer ACTCTGGGATGTCTTTGAGGTCA; Loop reverse primer AAACTTTGGAGATGCGGAATTTGTC. In some embodiments, the primer set described herein is used to amplify the PEDV N gene. In some embodiments, the primer set of the invention is labeled with a label in such a way that the 5 'end of the loop forward primer labels a first label and the 5' end of the inner forward primer labels a second label, the first label being different from the second label. In some embodiments, the label of the invention is selected from Biotin (Biotin), a fluorescent group. In some embodiments, the fluorophore of the invention comprises FITC, TAMRA, cy, cy5. In some