CN-121994761-A - In-situ detection method and application of heavy metal cadmium in plants
Abstract
The invention provides an in-situ detection method of heavy metal cadmium in plants and application thereof, the detection method is based on cadmium specific nucleic acid aptamer as an identification element, and the thiol-nucleic acid aptamer fluorescent probe is synthesized by coupling an affinity transmembrane oligomer compound, so that the in-situ rapid detection of heavy metal cadmium in plants is realized. The fluorescent probe for detecting heavy metal cadmium in the plant body comprises a thiol polymer and a cadmium nucleic acid aptamer fluorescent probe, wherein the thiol polymer comprises hexaethylene glycol interval and 15 repeated units of lipoic acid phosphorous, the nucleic acid aptamer fluorescent probe comprises an aptamer sequence and a connecting sequence which specifically identify heavy metal cadmium, a fluorescent group is marked in the middle of the aptamer sequence, and a quenching group is marked at the 3' -end of the aptamer sequence. Compared with the traditional cadmium detection technology for the heavy metal of the plant, the detection method provided by the invention is more sensitive, can meet the in-situ detection requirement of the heavy metal cadmium in the living body of the plant, is simple and feasible, does not need a large instrument, and is low in detection cost.
Inventors
- LUAN YUNXIA
- LIU QINGJU
- LI SUHUI
Assignees
- 北京市农林科学院
Dates
- Publication Date
- 20260508
- Application Date
- 20260113
Claims (10)
- 1. The fluorescent probe for detecting heavy metal cadmium in plants is characterized by comprising a thiol polymer and a cadmium nucleic acid aptamer fluorescent probe, wherein the thiol polymer comprises a lipoic acid phosphorous acid with a hexaethyleneglycol interval of 18 atoms and 15 repeating units and a DNA chain, the sequence of the DNA chain is shown as SEQ ID NO.1, the repeating units are low polymers of lipoic acid phosphorous monomers, the cadmium nucleic acid aptamer fluorescent probe comprises a complementary sequence of the DNA chain and an aptamer sequence for specifically recognizing heavy metal cadmium, the specific sequence is shown as SEQ ID NO.2, and the 15 th base T of the sequence marks a fluorescent group and the 3 ́ end marks a quenching group.
- 2. The fluorescent probe of claim 1, wherein the fluorescent moiety is FAM and the quenching moiety is TAMRA.
- 3. The fluorescent probe of claim 1, wherein the thiol polymer is mixed with the fluorescent probe in a molar concentration ratio of 1:1 for detection of heavy metal cadmium.
- 4. A detection reagent for the detection of heavy metal cadmium in plants, characterized in that it comprises a fluorescent probe according to any one of claims 1 to 3.
- 5. The reagent according to claim 4, further comprising a buffer solution containing Tris HCl at a final concentration of 10 mM, naCl at 140 mM, KCl at 5mM, and having a pH of 7.0.
- 6. The quantitative detection method of the heavy metal cadmium ions is characterized by comprising the following steps of: S1, preparing a cadmium sulfate standard substance into a series of cadmium ion-containing gradient concentration standard substance solutions through stepwise dilution; s2, incubating a solution containing the fluorescent probe according to any one of claims 1-3 with a sample solution to be detected and a standard solution respectively, measuring the fluorescence intensity of the incubated solution at an excitation wavelength of 488nm and an emission wavelength of 520nm by using an enzyme-labeled instrument, marking the fluorescence intensity of the incubated solution as F2, marking the fluorescence intensity of the incubated solution at an emission wavelength of 580nm as F1, and calculating the F1/F2 ratio; S3, drawing a standard curve according to the concentrations of standard substance solutions with different gradient concentrations and the F1/F2 ratio corresponding to the concentrations, and substituting F1/F2 of a sample to be detected into the standard curve to obtain the content of cadmium ions in the solution to be detected.
- 7. The method for in-situ quantitative detection of heavy metal cadmium in plant living body according to claim 6, wherein the thiol polymer in the fluorescent probe and the cadmium nucleic acid aptamer fluorescent probe are configured according to an equimolar ratio, and the incubation condition is 37 ℃ for 10min.
- 8. The method for in-situ quantitative detection of heavy metal cadmium in a plant living body according to claim 7, wherein the concentration of the thiol polymer and the concentration of the cadmium nucleic acid aptamer fluorescent probe are 1-2 mu M, and the solvent for dissolving the thiol polymer and the cadmium nucleic acid aptamer fluorescent probe is Tris-HCl buffer solution with the final concentration of 10mM, pH7.0,140mM NaCl and 5 mMKCl.
- 9. A method for in-situ detection of cadmium metal in living plants, which is characterized in that a solution containing the fluorescent probe according to any one of claims 1 to 3 is injected into mesophyll of the plants, and the detection is carried out by a confocal imaging confocal microscope, and the detection result is judged as follows: when bright green and bright red fluorescence appears, it is indicated that there is no cd2+ in the mesophyll of the plant; When the red fluorescence is obviously reduced and the green fluorescence is kept bright, the Cd2+ exists in the mesophyll of the plant.
- 10. The method for in situ detection of heavy metal cadmium in plant living body according to claim 9, wherein the concentration of the solution thiol polymer of the fluorescent probe and the concentration of the cadmium nucleic acid aptamer fluorescent probe in the solution of the fluorescent probe are both 1.5 mu m, and the solvent is Tris-HCl buffer solution with final concentration of 10mM, 140 mM NaCl and 5mM KCl and pH value of 7.0.
Description
In-situ detection method and application of heavy metal cadmium in plants Technical Field The invention belongs to the technical field of heavy metal detection in plants, and particularly relates to an in-situ detection method and application of heavy metal cadmium in plants. Background Cadmium is one of the most biotoxic heavy metals, is easily absorbed by plants and accumulated in the liver or kidney in human body through gradual enrichment of biological chains, and even if the cadmium is in a micro-content, the cadmium can cause human health problems. The existing methods for detecting the cadmium of several heavy metals, such as an inductively coupled plasma mass spectrometry method, an atomic absorption spectrometry method and the like, lead to the fact that the detection precision of the cadmium is easily affected by other metal ions due to the existence of various interfering substances. These methods may face the challenges of inaccurate detection when analyzing complex samples and most detection methods focus on in vitro detection of cadmium and toxic effects of free cadmium in mammalian cells, and no studies have been reported for in situ quantitative detection of heavy metal cadmium in plant living bodies. Unlike animal and bacterial cells, plant cells have cell walls, so how to efficiently enter the plant cells by nucleic acid aptamers has been a problem in the field of functional nucleic acid living probes at home and abroad. Disclosure of Invention In order to solve the technical problems, the invention provides an in-situ quantitative detection technology for heavy metal cadmium in plants, which is based on the fact that a specific nucleic acid aptamer of cadmium is used as an identification element, a DNA chain of a synthetic coupling affinity transmembrane oligomer compound is used as a transmembrane element, fluorescence resonance energy transfer is combined as signal output, and cadmium in plant samples can be detected rapidly. In order to achieve the above purpose, the invention adopts the following technical scheme: In a first aspect, the invention provides a fluorescent probe for heavy metal cadmium detection in plants, which comprises a thiol polymer and a cadmium nucleic acid aptamer fluorescent probe, wherein the thiol polymer comprises a hexaethyleneglycol spacer (marked as/iSp 18 /) with 18 atoms and a lipoic acid phosphorous acid with 15 repeating units (marked as/SS /) and a DNA strand with the sequence of SEQ ID NO.1: ACACGCTGCTT, the cadmium nucleic acid aptamer fluorescent probe comprises a complementary sequence of the DNA strand and an aptamer sequence for specifically recognizing heavy metal cadmium, wherein the sequence of the DNA strand is marked with a fluorescent group and a 3-terminal mark quenching group, the sequence of the DNA strand is shown as SEQ ID NO.2:5'-GCAGCGTGTGTGTATCTCAGGACGACGGGTTCACAGTCCGTTGTC-3', the 15 th base T of the sequence marks the fluorescent group, the 3- ́ terminal mark quenching group, and the sequence of the complementary sequence of the DNA strand is shown as 5'-ACACGCTGCTT/iSp18// SS/15-3'. Wherein, the sequence of the aptamer for specifically recognizing heavy metal cadmium is shown as SEQ ID NO.3: CTCAGGACGACGGGTTCACAGTCCGTTGTC. Further, the fluorescent group is FAM, the quenching group is TAMRA, and the fluorescent group is FAM marked on the 15 th base T in the middle. The fluorescent group FAM and the quenching group TAMRA can be reasonably replaced by other fluorescent groups and quenching groups according to actual use requirements by a person skilled in the art, so that the effect of transmitting fluorescent signals is realized. Specifically, the thiol polymer is abbreviated as 5'-ACACGCTGCTT/isp18// SS/15-3' (SS-HS), and the cadmium nucleic acid aptamer fluorescent probe is abbreviated as 5'-GCAGCGTGTGTGTAT/i6-FAM/CTCAGGACGACGGGTTCACAGTCCGTTGTC/36-TAMRA/-3' (CdS). When the fluorescent probe is used for detecting heavy metal cadmium, the thiol polymer and the cadmium nucleic acid aptamer fluorescent probe are mixed according to the molar concentration ratio of 1:1. The thiol polymer is prepared through DNA synthesizer to complete the synthesis and modification of the precursor for mediated aptamer transmembrane delivery, and trichloroacetic acid to eliminate DMT on the nucleoside connected to solid CPG to expose 5' hydroxyl for the next coupling step. Before coupling, the monomer is mixed with tetrazole and fed into a synthesis column, and the monomer is activated to form a phosphoramidite tetrazole intermediate. Phosphoramidite tetrazole is coupled to the 5' hydroxyl of the nucleotide and the tetrazole is removed, and the synthesized oligonucleotide chain is extended by one, in the same way, to obtain the mediating aptamer transmembrane delivery precursor required for the assay. The preparation of the cadmium nucleic acid aptamer fluorescent probe was synthesized by solid phase phosphoramidite triester chemistry from Shanghai tech