CN-122005596-A - Application of circular RNA in preparation of tumor inhibitor
Abstract
The invention provides an application of a circular RNA in preparing a tumor inhibitor, wherein the circular RNA has a circular structure formed by splicing a nucleotide sequence shown as SEQ ID NO.1 after transcription. The invention creatively discovers that the expression level of the circular RNA (CircCYTB-174) in cancer cells is obviously lower than that of normal cells, and the introduction of CircCYTB-174 into the cancer cells can not influence the expression level of linear CYTB mRNA, but can obviously inhibit the proliferation of the cancer cells, promote the apoptosis of the cancer cells, has no killing effect on the normal cells and has excellent tumor inhibition effect.
Inventors
- LIU XINGGUO
- Zhou yunhao
- HUANG YILE
- YANG LIANG
Assignees
- 中国科学院广州生物医药与健康研究院
Dates
- Publication Date
- 20260512
- Application Date
- 20260407
Claims (10)
- 1. Use of a cyclic RNA having a cyclic structure formed by splicing after transcription of a nucleotide sequence shown in SEQ ID No.1 for the preparation of a tumor suppressor.
- 2. The use according to claim 1, wherein the circular RNA comprises a circular structure of the nucleotide sequence shown in SEQ ID No.2 joined end to end.
- 3. The use of claim 1 or 2, wherein the tumor comprises any one or a combination of at least two of small cell lung cancer, non-small cell lung cancer, papillary thyroid cancer, glioblastoma multiforme, colon cancer, rectal cancer, head and neck cancer, kidney cancer, bladder cancer, breast cancer, ovarian cancer, liver cancer, cholangiocarcinoma, sarcoma, acute myelogenous leukemia, large cell neuroendocrine cancer, neuroblastoma, prostate cancer, pancreatic cancer, melanoma, head and neck squamous cell carcinoma, cervical cancer, skin cancer, glioma, esophageal cancer, oral squamous cell carcinoma, or gastric cancer.
- 4. The use according to any one of claims 1 to 3, wherein the tumor suppressor further comprises an adjuvant; Preferably, the auxiliary materials comprise any one or a combination of at least two of solvents, emulsifying agents, dispersing agents, wetting agents, adhesives, stabilizing agents, coloring agents, diluents, flavoring agents or fillers; Preferably, the dosage form of the tumor inhibitor comprises any one of tablets, powder, suspension, injection, spray, solution, enema, emulsion, film, suppository, capsule, medicinal granules, dripping pills or granules.
- 5. Use of a circular RNA having a circular structure formed by splicing after transcription of a nucleotide sequence shown in SEQ ID No.1 for the preparation of a proliferation inhibitor or an apoptosis promoter of a cell.
- 6. The use according to claim 5, wherein the circular RNA comprises a circular structure formed by joining the nucleotide sequences shown in SEQ ID NO.2 end to end.
- 7. The use of claim 5 or 6, wherein the cells comprise any one of a549 cells or K562 cells.
- 8. The combined pharmaceutical composition is characterized by comprising a circular RNA and a gene delivery carrier, wherein the circular RNA has a circular structure formed by splicing a nucleotide sequence shown as SEQ ID NO.1 after transcription, and the gene delivery carrier is used for promoting the circular RNA to be introduced into cells.
- 9. The pharmaceutical combination according to claim 8, wherein the circular RNA comprises a circular structure comprising the nucleotide sequence shown in SEQ ID No.2 joined end to end.
- 10. The pharmaceutical combination according to claim 8 or 9, wherein the pharmaceutical combination is a single compound preparation; Preferably, the combination pharmaceutical composition further comprises pharmaceutically acceptable excipients; Preferably, the auxiliary material comprises any one or a combination of at least two of a solvent, an emulsifying agent, a dispersing agent, a wetting agent, a binding agent, a stabilizing agent, a coloring agent, a diluting agent, a flavoring agent or a filling agent.
Description
Application of circular RNA in preparation of tumor inhibitor Technical Field The invention belongs to the technical field of bioengineering, and particularly relates to application of circular RNA in preparation of a tumor inhibitor. Background Cancer is the first leading cause of death, with approximately 130.7 deaths from cancer among 10 million people. According to the death rate of cancers, lung cancer, gastric cancer, liver cancer, colorectal cancer and pancreatic cancer are sequentially carried out from high to low, and the death rate of the five cancers accounts for about 70 percent of the total death rate of the cancers. In men, the number of deaths of four cancers, namely lung cancer, gastric cancer, liver cancer and colorectal cancer, accounts for 70% of all men's cancer deaths. In women, the death number of five cancers, namely gastric cancer, lung cancer, liver cancer, colorectal cancer and pancreatic cancer, accounts for 60 percent of the death number of all female cancers. Among them, lung cancer is a malignant tumor originating from the bronchus mucosa or glands of the lung, and the incidence and death rate increase most rapidly, which is one of the malignant tumors that are the most threatening to the health and life of people. The early lung cancer has no obvious symptoms, is often ignored by people, and the clinical symptoms are reached to middle and late stages, at which time the surgical opportunity is often lost, so that the early treatment of the lung cancer becomes particularly important. Therefore, the development of tumor inhibitors is of great importance. Disclosure of Invention Aiming at the defects of the prior art, the invention aims to provide an application of circular RNA in preparing a tumor inhibitor, and creatively discovers that the circular RNA (CircCYTB-174) can obviously inhibit proliferation of cancer cells, promote apoptosis of the cancer cells and has an excellent tumor inhibition effect. In order to achieve the aim of the invention, the invention adopts the following technical scheme: in a first aspect, the invention provides the use of a circular RNA having a circular structure formed by splicing after transcription of the nucleotide sequence shown in SEQ ID NO.1 in the preparation of a tumor suppressor. SEQ ID NO.1: ATGACCCCAATACGCAAAACTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCCCATCCAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATAGCAACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTTGCCCTTCATTATTGCAGCCCTAGCAACACTCCACCTCCTATTCTTGCACGAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCCTCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCCCTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCTAATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCT. SEQ ID NO.2: CAATAATCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCA. The human CYTB gene has a nucleotide sequence as set forth in SEQ ID No.1, which is located on the mitochondrial genome (position: 14737.. 15877), encoding the respiratory chain protein CYTB protein. Human CYTB gene is spliced after transcription to form end-to-end circular RNA (CircCYTB-174), and CircCYTB-174 has a nucleotide sequence shown as SEQ ID NO. 2. The invention creatively discovers that the expression level of the circular RNA (CircCYTB-174) in cancer cells is obviously lower than that of normal cells, and the introduction of CircCYTB-174 into the cancer cells can not influence the expression level of linear CYTB mRNA, but can obviously inhibit the proliferation of the cancer cells, promote the apoptosis of the cancer cells, has no killing effect on the normal cells and has excellent tumor inhibition effect. Preferably, the circular RNA comprises a circular structure formed by connecting nucleotide sequences shown in SEQ ID NO.2 end to end. Preferably, the circular RNA is a synthetic circular RNA or the CYTB gene in a cell is spliced after transcription to form a circular RNA. Preferably, the tumor comprises any one or a combination of at least two of small cell lung cancer, non-small cell lung cancer, papillary thyroid cancer, glioblastoma multiforme, colon cancer, rectal cancer, head and neck cancer, kidney cancer, bladder cancer,