CN-122005796-A - Application of lactogenesis modifier gene ENO1 inhibitor in preparation of medicines for treating nasopharyngeal carcinoma
Abstract
The invention discloses application of a lactate modification gene ENO1 inhibitor in preparation of a medicament for treating nasopharyngeal carcinoma, and relates to the technical field of biological medicines. According to the invention, a TCGA database is analyzed to construct a head and neck squamous cell carcinoma prognosis model containing 7 lactate related genes, the model can effectively distinguish patient risks, the total survival time of a high risk group is obviously shortened, the risk score is an independent prognosis factor, the function of a key gene ENO1 is deeply researched through in vitro experiments, and experimental results show that the silencing of the ENO1 gene in nasopharyngeal carcinoma 5-8F cells leads to up-regulation of the ubiquitination level of the cells, and leads to up-regulation of MMP2 expression and down-regulation of E-cadherin expression, and the migration and invasion capacity of tumor cells are obviously enhanced. The prognosis model provided by the invention has important clinical prediction value, and can inhibit ENO1 from promoting tumor progress through abnormal lactogenesis, thereby providing a new idea for taking ENO1 as a treatment target.
Inventors
- WANG GANG
- CHEN QICONG
- QU SHENHONG
- LUO HONGLIN
- Nong Wenqian
- CHEN YANG
- Zou Xiaosu
- Xie Sifang
- DENG WEIMING
Assignees
- 广西壮族自治区人民医院
Dates
- Publication Date
- 20260512
- Application Date
- 20251029
Claims (6)
- 1. The application of the lactogenesis modifier gene ENO1 inhibitor in preparing the medicine for treating the nasopharyngeal carcinoma is characterized in that the ENO1 inhibitor is used for regulating the lactogenesis metabolism of the nasopharyngeal carcinoma and the tumor cell migration and invasion processes.
- 2. The use of the lactate modification gene ENO1 inhibitor according to claim 1 for the preparation of a medicament for the treatment of nasopharyngeal carcinoma, wherein said ENO1 inhibitor comprises one or more combinations of shENO1, AP-III-a4, hex, SF 2312.
- 3. The use of the lactate modification gene-ENO 1 inhibitor according to claim 2, wherein shENO is used for silencing ENO1 gene in the preparation of a medicament for treating nasopharyngeal carcinoma.
- 4. The use of the lactic acid modification gene ENO1 inhibitor according to claim 2, wherein shENO1 is obtained by inserting a DNA fragment containing an ENO1 targeting sequence into a lentiviral expression vector VP 013-U6-MCS-CMVZsGreen-PGK-PURO.
- 5. The use of the lactic acid modification gene ENO1 inhibitor according to claim 2 for preparing a medicament for treating nasopharyngeal carcinoma, wherein the nucleotide sequence of the shRNA is shown as sequence SED ID No. 1.
- 6. The use of a lactate modification gene ENO1 inhibitor according to any one of claims 1-5 for the manufacture of a medicament for the treatment of nasopharyngeal carcinoma, wherein shENO1 is capable of up-regulating the level of modification of cellular lactate, up-regulating the level of MMP2 expression in tumor cells and down-regulating E-cadherein expression.
Description
Application of lactogenesis modifier gene ENO1 inhibitor in preparation of medicines for treating nasopharyngeal carcinoma Technical Field The invention relates to the technical field of biological medicines, in particular to application of a lactate modification gene ENO1 inhibitor in preparation of a medicine for treating nasopharyngeal carcinoma. Background Nasopharyngeal carcinoma is a malignant tumor occurring on the mucous membrane epithelium of the nasopharynx part, has obvious regional distribution characteristics, and most patients already progress to local advanced or late stages when diagnosed because the disease is hidden in onset and early symptoms are atypical, so that the treatment difficulty is extremely high. At present, radiotherapy and chemotherapy are the main treatment means, but have poor treatment effects on advanced, recurrent or metastatic nasopharyngeal carcinoma and poor prognosis of patients. Thus, there is a need to find new effective therapeutic targets and drugs. Enolase 1 (ENO 1) is a key metabolic enzyme in the glycolytic pathway, which has been found to be abnormally high expressed in a variety of tumors in recent years, and promotes tumor progression through its metabolic and non-metabolic functions. Protein lactonization modification is a novel post-translational modification of proteins, whose role in tumorigenesis development is gradually revealed. Although ENO1 has been shown to be involved in metabolic reprogramming and tumor progression in malignant tumors such as colorectal cancer, pancreatic cancer, etc., its specific role has not been clarified in the field of nasopharyngeal cancer. For example, chinese patent CN117721109A (publication time: 2024, 3 months and 19 days) discloses a shRNA sequence aiming at ENO1 gene and application thereof in colorectal cancer treatment, specifically designs a shENO sequence for silencing ENO1 gene, clones shENO sequence to lentivirus expression vector pLKO.1, packages lentivirus, infects human colorectal cancer cells, successfully reduces mRNA and protein expression level of ENO1 in human colorectal cancer cells, thereby remarkably inhibiting growth rate of colorectal cancer cells, and has very important significance in colorectal cancer treatment. The shENO sequence designed by the invention is convenient to develop into clinical therapeutic drugs for treating colorectal cancer, and has wide market application prospect and potential social and economic benefits. Also, for example, chinese patent No. 119405814A (publication time: 2025, 2, 11) discloses the use of ENO1 as a target in the preparation of a pharmaceutical composition for the treatment of bladder cancer. The pharmaceutical composition for treating bladder cancer is a targeted inhibitor of ENO 1. The inhibitor is shRNA. The experimental result of the invention shows that ENO1 is a potential therapeutic target for bladder cancer progression, and the development of a medicament for inhibiting the expression level of ENO1 is expected to provide a new strategy for bladder cancer treatment. At present, the field of nasopharyngeal carcinoma treatment still lacks an accurate treatment strategy capable of specifically targeting tumor cells for abnormal lactate metabolism and effectively inhibiting migration and invasion. The existing means are mostly based on a broad-spectrum killing principle, and cannot intervene in the key biological process of modification of the lactic acid, so that the curative effect is insufficient and the toxic and side effects are obvious. Therefore, the development of the lactic modification key regulatory factor provides a new path for treating cancers such as nasopharyngeal carcinoma. Disclosure of Invention In order to solve the problems, the invention provides application of the lactate modification gene ENO1 inhibitor in preparing medicaments for treating nasopharyngeal carcinoma, and provides a new strategy for treating the nasopharyngeal carcinoma. The ENO1 inhibitor is used for regulating the lactate metabolism of nasopharyngeal carcinoma and the migration and invasion processes of tumor cells. Further, the ENO1 inhibitor comprises shENO1, AP-III-a4, hex and SF2312. Further, shENO is used to silence the ENO1 gene. Furthermore, shENO is obtained by inserting a DNA fragment containing an ENO1 targeting sequence into a lentiviral expression vector VP 013-U6-MCS-CMVZsGreen-PGK-PURO. Further, the specific sequence of shENO1 is GGATCCGCGGTTCTCATGCTGGCAACACTCGAGTGTTGCCAGCATGAGAACCGCTTTTTTGAATTC (SED ID NO. 1). Further, shENO1 was able to up-regulate the level of modification of cellular lactogenesis, up-regulate MMP2 expression levels in tumor cells and down-regulate E-cadherein expression. Compared with the prior art, the application has the following advantages and effects: 1. By targeting mRNA of ENO1, shENO of the application can efficiently and selectively countersink the expression of the ENO1 gene, thereby up-regulating the lactate modificati