Search

CN-122012261-A - Scheffersomyces SPARTINAE QY strain Scheffersomyces SPARTINAE QY for resisting Pyricularia oryzae and application thereof

CN122012261ACN 122012261 ACN122012261 ACN 122012261ACN-122012261-A

Abstract

The invention belongs to the technical field of biological control of plant diseases, and particularly relates to Scheffersomyces SPARTINAE QY strain 22 and application thereof in biological control of rice blast resistance. The experimental methods such as strain separation, culture, identification and antibacterial effect evaluation provided by the invention prove that Scheffersomyces SPARTINAE QY has remarkable inhibition effect on various plant pathogenic bacteria and shows broad-spectrum antagonistic performance. Through a co-culture experiment, scheffersomyces SPARTINAE QY can obviously inhibit the growth of the rice blast fungus, the mycelium pellet shows a dissolution sign, the autophagy of the rice blast fungus is induced, and the powerful antibacterial capability of the rice blast fungus is shown. Scheffersomyces SPARTINAE QY22 as a novel biological control agent provides a novel non-chemical and environment-friendly method for controlling rice blast, reduces potential threats to environment and human beings, and has excellent performance in controlling rice blast, which indicates that the novel biological control agent can be widely applied as an agricultural biological agent in the future, reduces pesticide use and improves crop safety.

Inventors

  • ZHANG WENZHOU
  • CHI YULANG
  • PENG FEI

Assignees

  • 泉州医学高等专科学校

Dates

Publication Date
20260512
Application Date
20241107

Claims (5)

  1. 1. A strain of rice blast resistant bacterium Scheffersomyces SPARTINAE QY, which is deposited at the cantonese province microorganism strain collection on 9/6 of 2024 under the accession number GDMCC No:65109.
  2. 2. An anti-Pyricularia oryzae is characterized in that its ITS gene sequence is shown in SEQ ID NO. 1.
  3. 3. The use of the rice blast resistant bacterium Scheffersomyces SPARTINAE QY according to claim 1 or the rice blast resistant bacterium according to claim 2 for controlling rice blast.
  4. 4. A biological agent, characterized in that the active ingredient of the biological agent comprises Scheffersomyces SPARTINAE QY against Pyricularia oryzae according to claim 1 or 2.
  5. 5. A Scheffersomyces spartinae screening method, which is a counter-cultivation method, is characterized by comprising the following steps: step 1, cutting a bacterial cake from a flat plate containing plant disease fungi, and accurately inoculating the bacterial cake to the central position of a PDA culture medium flat plate; step 2, inoculating Scheffersomyces on the circumference 20-30mm away from the edge of the bacterial cake in a streaking mode spartinae; Step 3, directly observing and recording whether Scheffersomyces spartinae has an inhibition effect on the growth of plant disease fungi; and 4, primarily screening out strains which show remarkable inhibition ability on rice blast bacteria.

Description

Scheffersomyces SPARTINAE QY strain Scheffersomyces SPARTINAE QY for resisting Pyricularia oryzae and application thereof Technical Field The invention belongs to the technical field of biological control of plant diseases, and particularly relates to Scheffersomyces SPARTINAE QY strain 22 and application thereof in biological control of rice blast resistance. Background Pyricularia oryzae (Magnaporthe oryzae) is a fungus, also known as Pyricularia oryzae, fever, click fever, etc. It is one of the most destructive diseases on rice, and is called seedling, leaf, ear, node, etc. which are respectively called seedling plague, leaf plague, ear plague and node plague. Rice blast can occur throughout the entire growth period of rice, and is distributed throughout the world's rice field, the major disease in rice farming. The rice blast preventing and controlling method mainly selects disease-resistant varieties, cultivates high-quality seedlings, adopts fertilizer and water management technical measures, strengthens field management, realizes preventing and controlling measures, controls chemical agents and the like. The control methods are low in efficiency, have a certain threat to the environment, plants and human health, and the current methods for biologically controlling the rice blast fungi are few and mainly comprise bacteria of bacillus, so that the development of microorganisms capable of effectively controlling the rice blast fungi is one of the important points of research. Scheffersomyces spartinae is a yeast, commonly found in plants such as Studies (spartina). As a relatively new finding, scheffersomyces spartinae is still in the beginning of research in the agricultural and biotechnology fields. However, yeasts have shown significant potential in many fields. In the agricultural field, researchers are increasingly interested in methods for combating crop diseases using natural microorganisms, and yeasts as a natural microorganism are widely studied for controlling plant diseases. Scheffersomyces spartinae is a yeast symbiotic with plants and has potential disease resistance properties, and the influence on plant health has led researchers to interest. In the field of biotechnology, saccharomycetes are always an important research object and are widely applied to the fields of food fermentation, biological medicine production, enzyme engineering and the like. In recent years, research on non-traditional yeasts has been increasingly paid attention to, and Scheffersomyces spartinae is a novel yeast, and potential applications of the yeast in the aspects of food industry, biological energy sources, environmental protection and the like are also paid attention. In a word, although the research about Scheffersomyces spartinae is still in the primary stage, the yeast has a wide application prospect as a novel yeast, and can play an important role in the fields of agricultural production, biotechnology, environmental protection and the like. Pyricularia oryzae is the main cause of rice blast, and the prevention and control of Pyricularia oryzae is always the focus of research by scientific researchers, and the research aims at inhibiting the growth of Pyricularia oryzae by Scheffersomyces SPARTINAE QY and makes a contribution to the prevention and control of rice blast. Disclosure of Invention Aiming at the defects of the prior art, the invention provides Scheffersomyces SPARTINAE QY for resisting rice blast bacteria and application thereof. The technical scheme of the invention is as follows: In a first aspect, the invention provides a rice blast resistant bacterium Scheffersomyces SPARTINAE QY, the strain has a preservation number of GDMCC No:65109, the preservation unit is the Guangdong province microorganism strain preservation center, the preservation address is the building 5 of the No. 59 institute of the No. 100 university in Guangzhou martyr, the preservation date is 2024, 09 and 06 days, and the classification is Scheffersomyces spartinae. In a second aspect, the present method provides an anti-Pyricularia oryzae having an ITS gene sequence comprising SEQ ID NO.1. SEQ ID NO.1 is: TTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAACATGGTTTGTTTTTGTAAGGCTGGGCCTGAAC AAACAGTTTCCAAGACTTCAATGATGGATAAACCTAATACATTGATTGTCGAGTGCGCTGTATTGCACCGCTCCTGCCAA TACTTTTCAAGCAAACACCTAGTCTGACTAAGAGTATCACTCAAAACCAAACCCGAAGGTTTGAGAGAGAAATGACGCTC AAACAGGCATGCCCCTTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGAAAATCTGCAATTCAT ATTACTTATCGCAATTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAATTAAATTT CATATTGACAATTAAAATTAATAAACCATTCAATAAAAATTGAAGTTAGTTAAACCTCTGGCCCAACATCATTTCTGATG ACAGACCAAAGCAATGAGTTCAAAAAAGAAAACACAGTGTGTAATGTTCACCGCGCAGTTAAGCGCAGGCAAAATACTGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTTTACTTTCCA. In a third aspect, based on the same invention, the invention also provides an application of the rice blast resistant bacteria Scheffersomyces SPARTINAE QY in preventing and controlling rice blast bacteria