Search

CN-122012458-A - Modified efficient compact RNA base editing system

CN122012458ACN 122012458 ACN122012458 ACN 122012458ACN-122012458-A

Abstract

An improved efficient compact RNA base editing system belongs to the technical field of biology. The invention aims to enhance the binding affinity and stability of emini-dPspCas13 with crRNA, so that the editing efficiency of the modified efficient compact RNA base editing system is remarkably improved compared with that of the original REPAIR system and the non-optimized MINIREPAIR system. The editing system is a fusion protein, and the fusion protein comprises a miniature inactivated Cas13 protein emini-dPspCas b and an adenosine deaminase structural domain ADAR2DD to obtain EMINIREPAIR. The system has the characteristics of high efficiency and small size, and is suitable for accurately editing RNA of various cells and in vivo.

Inventors

  • LI ZHANJUN
  • ZHAO DING
  • LI JINZE
  • SUN RUI
  • GAO XUN
  • CHEN ZHENRU

Assignees

  • 吉林大学第一医院

Dates

Publication Date
20260512
Application Date
20251216

Claims (3)

  1. 1. An engineered efficient compact RNA base editing system, characterized by: The editing system is a fusion protein, the fusion protein comprises a miniature inactivated Cas13 protein emini-dPspCas b and an adenosine deaminase domain ADAR2DD, emini-dPspCas b is obtained by deleting dPspCas b and mutating, the amino acid sequence of emini-dPspCas13b is based on mini-dPspCas13, and comprises 5 activity enhancement mutations positioned in the interface loop region of the interaction with crRNA, wherein the activity enhancement mutations comprise E621R, A729 37738R, D739R, E875R, and the EMINIREPAIR amino acid sequence is SEQ ID NO 3.
  2. 2. The modified efficient compact RNA base editing system of claim 1, wherein the construction process of EMINIREPAIR is as follows: s1, mutant screening and vector construction: Determining key loop regions of dPspCas b protein which interact with crRNA, designing site-directed mutagenesis, and constructing plasmids of 74 single-point mutants; s2, efficiency evaluation of single-point mutants: Co-transfecting each single-point mutant plasmid and an ADAR2DD expression frame as well as a crRNA expression plasmid targeting an endogenous gene PPIB site into HEK293T cells, wherein the crRNA sequence of the PPIB is CAAAGATCACCCGGCCCACATCTTCATCTCCAATTCGTAGGTCAAAATAC; the 5 key mutation sites are E621R, A729R, E738R, D739R, E875R; s3, commonly introducing the screened five high-efficiency single-point mutations into a gene sequence of mini-dPspCas b to construct a combined mutant emini-dPspCas b.
  3. 3. The modified efficient compact RNA base editing system according to claim 1 or 2, wherein the combined mutant emini-dPspCas b is fused by a flexible linker and cloned into an expression vector to finally construct a EMINIREPAIR system.

Description

Modified efficient compact RNA base editing system Technical Field The invention belongs to the field of biotechnology. Background The RNA editing technology opens up a new approach for the treatment of genetic diseases due to the unique advantages of reversibility, space-time specificity regulation, accurate editing window and the like. In 2017, the REPAIR (RNA EDITING for Programmable A to I REPLACEMENT) system was developed by team Zhang Feng. REPAIR is a programmable A-to-I converted RNA base editing system derived from fusion of an inactivated PspCas b protein (dPspCas b) with a highly active double stranded RNA adenosine deaminase domain (ADAR 2DD,385 amino acids). However, the molecular weight of the core component dPspCas b (1090 amino acids) of this system is too large, exceeding the packaging capacity limit of 4.7kb for AAV vectors (REPAIR: 1475 amino acids), severely restricting its use in gene therapy. In recent years, researchers have focused on developing more compact RNA editing systems, reporting new REPAIR systems based on miniaturized Cas13 proteins such as Cas13x.1, cas13bt1, and the like. These systems, while successful in solving the vector capacity problem of AAV delivery, still suffer from significant drawbacks in editing efficiency. Therefore, the development of a novel repir system with high efficiency and small size has become a key technical bottleneck to be broken through in the current RNA editing and treatment field. Solving the problem, the clinical transformation of the RNA editing technology is obviously promoted, and a safer and more accurate treatment strategy is provided for the hereditary diseases. Although the size of RNA editors can be reduced by rational design, domain deletion is also accompanied by loss of function, resulting in reduced editing efficiency. The MINIREPAIR system (1051 amino acids) developed solves the size problem, but its editing efficiency is reduced. Therefore, on the basis of realizing miniaturization, how to greatly improve the editing efficiency of the technology becomes another key problem which must be solved before the technology goes to clinical application. Directed evolution of proteins is a powerful means of enhancing protein function, but its application to complex CRISPR systems, especially for optimization of their interaction interface with RNA, faces significant challenges including selection of mutation sites and combinatorial effects of beneficial mutations, etc. Disclosure of Invention The invention aims to enhance the binding affinity and stability of emini-dPspCas13 with crRNA, so that the editing efficiency of the modified efficient compact RNA base editing system is remarkably improved compared with that of the original REPAIR system and the non-optimized MINIREPAIR system. The editing system is a fusion protein, the fusion protein comprises a miniature inactivated Cas13 protein emini-dPspCas13b and an adenosine deaminase structural domain ADAR2DD, emini-dPspCas b is obtained by deleting and mutating dPspCas b, the amino acid sequence of emini-dPspCas13b is based on mini-dPspCas and comprises 5 activity enhancement mutations positioned in a loop region of an interaction interface between the fusion protein and crRNA, the activity enhancement mutations comprise E621R, A729R, E738R, D739R, E875R, and the EMINIREPAIR amino acid sequence is SEQ ID NO:3. The construction process of the invention EMINIREPAIR comprises the following steps: s1, mutant screening and vector construction: Determining key loop regions of dPspCas b protein which interact with crRNA, designing site-directed mutagenesis, and constructing plasmids of 74 single-point mutants; s2, efficiency evaluation of single-point mutants: Co-transfecting each single-point mutant plasmid and an ADAR2DD expression frame as well as a crRNA expression plasmid targeting an endogenous gene PPIB site into HEK293T cells, wherein the crRNA sequence of the PPIB is CAAAGATCACCCGGCCCACATCTTCATCTCCAATTCGTAGGTCAAAATAC; the 5 key mutation sites are E621R, A729R, E738R, D739R, E875R; s3, commonly introducing the screened five high-efficiency single-point mutations into a gene sequence of mini-dPspCas b to construct a combined mutant emini-dPspCas b. The invention fuses the combined mutant emini-dPspCas13b through a flexible connector and clones the fused mutant to an expression vector, and finally constructs a EMINIREPAIR system. The system has the characteristics of high efficiency and small size, and is suitable for accurately editing RNA of various cells and in vivo. Drawings FIG. 1 is a schematic diagram of an evaluation of the efficiency of mutation based on different amino acids 13 b-MINIREPAIR; FIG. 2 is a schematic diagram of a different REPAIR vector construction; FIG. 3 is an evaluation of different REPAIR systems in HEK293 cells; FIG. 4 is a schematic diagram of the structure of dPspCas b; FIG. 5 is a schematic diagram of MINIREPAIR vector construction, where RE represents the