Search

CN-122012506-A - SgRNA and target DNA for detecting SpCas 9D 10A Nickase activity and detection method

CN122012506ACN 122012506 ACN122012506 ACN 122012506ACN-122012506-A

Abstract

The invention provides sgRNA and target DNA for detecting SpCas 9D 10A Nickase activity and a detection method. The invention establishes a reaction system capable of expressing the function and a quantitative detection method (IEX-HPLC method) by simulating the activity function of the base editing enzyme nickase, obviously reduces the requirements on experimental animals and cells, shortens the detection period, accords with the 3R (reduction, optimization and substitution) principle of modern scientific research, simultaneously provides an efficient and practical analysis method for the quality characteristic analysis of the base editing enzyme, improves the convenience of quality detection in the production and research of gene editing products, and has a large-scale commercial application prospect.

Inventors

  • DONG ZONGZONG
  • ZHANG HAIDAN
  • ZHAI ZHIXU

Assignees

  • 恺佧生物科技(上海)有限公司

Dates

Publication Date
20260512
Application Date
20260323

Claims (10)

  1. 1. An sgRNA is characterized by comprising a sequence shown as SEQ ID No. 1.
  2. 2. An sgRNA as claimed in claim 1, characterized in that it is a sequence as shown in SEQ ID No. 2.
  3. 3. Use of the sgRNA of claim 1 or 2 in a SpCas 9D 10A Nickase activity assay.
  4. 4. A target DNA comprising a sequence shown as SEQ ID No. 3.
  5. 5. A target DNA according to claim 4, wherein the sequence is as shown in SEQ ID No. 4.
  6. 6. Use of the target DNA of claim 4 or 5 in a SpCas 9D 10A Nickase activity assay.
  7. 7. A product for detecting the activity of SpCas 9D 10A Nickase is characterized by comprising target DNA shown as SEQ ID No.3 or SEQ ID No.4 and sgRNA capable of recognizing a sequence shown as SEQ ID No. 5.
  8. 8. A product for detecting the activity of SpCas 9D 10A Nickase is characterized by comprising sgRNA shown as SEQ ID No.1 or SEQ ID No.2 and target DNA shown as SEQ ID No.3 or SEQ ID No. 4.
  9. 9. A method for detecting the activity of SpCas 9D 10A Nickase is characterized in that after target DNA is specifically cut by a complex of SpCas 9D 10A Nickase protein and sgRNA, the content of a ring-opened plasmid is detected, and the difference between the content of the ring-opened plasmid added with SpCas 9D 10A Nickase protein and the ring-opened plasmid without SpCas 9D 10A Nickase protein is calculated to be the activity detection result; Wherein, the sgRNA is shown as SEQ ID No.1 or SEQ ID No. 2; The target DNA is shown as SEQ ID No.3 or SEQ ID No. 4.
  10. 10. The method for detecting the activity of SpCas 9D 10A Nickase according to claim 9, wherein the determination of the content of the open-loop plasmid is performed by ion exchange chromatography.

Description

SgRNA and target DNA for detecting SpCas 9D 10A Nickase activity and detection method Technical Field The invention relates to the field of biological analysis, in particular to sgRNA and target DNA for detecting SpCas 9D 10A Nickase activity and a detection method. Background The evaluation of biological properties is an equally important step as the overall structural validation of the product, reflecting the ability of the product to exert the intended biological effect, a key quality attribute. The method for measuring the biological activity comprises a biological activity detection method based on animals, which is used for measuring the biological response of a biological organism to a product, a biological activity detection method based on cell culture, which is used for measuring the biochemical and physiological effects of the product at the cellular level, and a biochemical method, which is used for measuring the biological activity by using methods such as enzyme reaction rate or biological response induced by immune interaction. The method based on animal and cell biology cannot get rid of the requirements on animals and cells, and has high requirements on experimental environment and conditions and long detection period. At present, the in-vitro activity detection method of similar products in the market is mainly a gel method, and because the gel method is difficult to accurately quantify and can not provide continuous quantitative data, a large error is generated in the judgment of the biological activity result, and the quality evaluation of the products is influenced. Disclosure of Invention The invention aims to overcome the defects, establishes a reaction system capable of expressing the function and a quantitative detection method (IEX-HPLC method) by simulating the function of the base editing enzyme nickase activity, obviously reduces the requirements on experimental animals and cells, shortens the detection period, accords with the 3R (reduction, optimization and substitution) principle of modern scientific research, simultaneously provides a high-efficiency and practical analysis method for the quality characteristic analysis of the base editing enzyme, improves the convenience of quality detection in the production and research of gene editing products, and has a large-scale commercial application prospect. The invention provides an sgRNA comprising a sequence as shown in SEQ ID No. 1. SEQ ID No.1:mCmUmAACAGUUGCUUUUAUCAC。 The invention also provides an sgRNA which is a sequence shown as SEQ ID No. 2. SEQ ID No.2：mCmUmAACAGUUGCUUUUAUCACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCmUmUmUU. Furthermore, the invention also provides an application of the sgRNA shown in the SEQ ID No.1 or the SEQ ID No.2 in the activity test of the SpCas 9D 10A Nickase. In addition, the invention also provides a target DNA, which comprises a sequence shown as SEQ ID No. 3. SEQ ID No.3:CTAACAGTTGCTTTTATCAC。 In addition, the invention also provides a target DNA, which is a sequence shown as SEQ ID No. 4. SEQ ID No.4：TGATGGACCTTGGGTGCTATTCCTGTGATAAGGAAGGCAGCTAGACAGGACTTGGGAGTTATCTGTAGTGAGATGGCTGAAAAGCGATACAGGGCTGGCTCTATGCCCCAGGTGTGCATAAGTAAGAGCAGATAGCTGATTCCAGTGCAAAGTCCATACAGGTAATAACATAGGCCAGAAAAGAGATATGGCATCTACTCTTAGACATAACACACCAGGGTCAATACAACTTTGAAGCTAGTCTAGTGCAAGCTAACAGTTGCTTTTATCACAGGCTCCAGGAAGGGTTTGGCCTCTGATTAGGGTGGGGGCGTGGGTGGGGTAGAAGAGGACTGGCAGACCTCTCCATCGGTGGCCGTTTGCCCAGGGGGGCCTCTTTCGGAAGGCTCTCTTGGTGATGGAGAATTGGATTTTATTTCTCAATGGGAATGAAATAATTTGTATGCCATGCCGTGTGGAC. Furthermore, the invention also provides application of the target DNA shown in the SEQ ID No.1 or the SEQ ID No.2 to activity test of the SpCas 9D 10A Nickase. In addition, the invention also provides a product for detecting the activity of SpCas 9D 10A Nickase, which comprises target DNA shown as SEQ ID No.3 or SEQ ID No.4 and sgRNA capable of recognizing a sequence shown as SEQ ID No. 5. SEQ ID No.5:CTAACAGTTGCTTTTATCAC。 In addition, the invention also provides a product for detecting the activity of SpCas 9D 10A Nickase, which comprises sgRNA shown as SEQ ID No.1 or SEQ ID No.2 and target DNA shown as SEQ ID No.3 or SEQ ID No. 4. In addition, the invention also provides a method for detecting the activity of the SpCas 9D 10A Nickase, which specifically comprises the steps of specifically cutting target DNA by using a complex of the SpCas 9D 10A Nickase protein and sgRNA, detecting the content of a ring-opened plasmid, and calculating the difference value between the content of the ring-opened plasmid added with the SpCas 9D 10A Nickase protein and the ring-opened plasmid without the SpCas 9D 10A Nickase protein to obtain an activity detection result; Wherein, the sgRNA is shown as SEQ ID No.1 or SEQ ID No. 2; the target DNA is shown as SEQ ID No.3 or SEQ ID No. 4. Further, the method for detecting the activity of SpCas 9D 10A Nickase is characterized in that the content of the open-loop plasmid is measured