CN-122012510-A - Gossypol specific nucleic acid aptamer and preparation method and application thereof
Abstract
The invention provides a gossypol specific nucleic acid aptamer, a preparation method and application thereof, wherein the nucleotide sequence of the aptamer is shown as SEQ ID NO. 1. According to the invention, a Capture-SELEX technology is adopted, a high-throughput sequencing and DNAMAN homology and secondary structure analysis are combined through an optimized screening system, so that the gossypol specific nucleic acid aptamer is obtained, and is verified by ThT fluorescent measurement and ITC, the aptamer still maintains high affinity after being truncated, the molecular docking further confirms that the aptamer forms a hydrogen bond-hydrophobic effect with gossypol through key bases such as G-26, C-27, G-28 and G-46, and the like, thus laying a foundation for the subsequent rapid gossypol detection system construction.
Inventors
- ZHANG MINWEI
- ZHANG YU
- LI ZONGDA
- MA LONG
- QIN YANAN
Assignees
- 新疆大学
Dates
- Publication Date
- 20260512
- Application Date
- 20260206
Claims (10)
- 1. A gossypol specific nucleic acid aptamer is characterized in that the nucleotide sequence of the aptamer is shown as SEQ ID NO.1 (GCATAGGGAGGTCACACCGATAGTGGCGCAATCTAGTTGGTTAGCGCCCTATGC).
- 2. The method of screening for gossypol specific nucleic acid aptamers of claim 1, wherein the screening method comprises the steps of: S1, designing an initial library, uniformly mixing the initial library with a capturing chain, and performing renaturation treatment on the uniformly mixed mixture by using a PCR instrument to obtain ssDNA-Capture; S2, uniformly mixing ssDNA-Capture with streptavidin magnetic beads, incubating, separating the magnetic beads, and carrying out library positive screening to obtain a positive screening solution; S3, carrying out PCR amplification, centrifugation, melting, concentration and dialysis on the positive screening solution, and taking the collected single-stranded library as a secondary nucleic acid aptamer library; s4, repeating the steps S1-S3 for 14 rounds of screening, and performing high-throughput sequencing analysis on the single-stranded library obtained by screening to obtain the gossypol specific nucleic acid aptamer.
- 3. The method according to claim 2, wherein in step S1, the nucleotide sequence of the initial library is shown in SEQ ID NO.2 (ATTGGCACTCCACGCATAGG-N40-CCTATGCGTGCTACCGTGAA); the nucleotide sequence of the capturing chain is shown as SEQ ID NO.3 (CCTATGCGTGGAGTGCCAAT-C3 Spacer-biotin).
- 4. The method according to claim 2, wherein in step S1, the PCR apparatus is operated at a temperature of 95℃for 10min, 60℃for 5min, 25℃for 30min, 4℃for a forever, and a cooling rate of 0.1℃/S.
- 5. The screening method according to claim 2, wherein in the step S2, the method further comprises the step of sealing the nonspecific binding sites on the surface of the isolated magnetic beads before the library is screened, wherein herring sperm DNA, mg 2+ solution and screening buffer are mixed and then added into the magnetic beads, and the mixture is subjected to shaking incubation at room temperature; Preferably, the screening buffer is phosphate buffer containing dimethyl sulfoxide, the screening buffer does not contain Ca 2+ 、Mg 2+ , and further preferably, the concentration of the dimethyl sulfoxide in the screening buffer is 2%.
- 6. The method according to claim 2, wherein step S2 further comprises the step of performing reverse screening before the library is screened, wherein the screening buffer and/or gossypol acetate are used for incubation with magnetic beads by shaking at room temperature; Preferably, the reverse screening is carried out on the 1 st round, the 2 nd to 6 th round and the 9 th to 12 th round, further preferably, the reverse screening is carried out on the 1 st round by using screening buffer solution, and the reverse screening is carried out on the 2 nd to 6 th round and the 9 th to 12 th round by using gossypol acetate; preferably, the method for positive screening comprises the steps of mixing gossypol with magnetic beads, and incubating under shaking at room temperature.
- 7. The screening method according to claim 2, wherein in step S3, the primers used for the PCR amplification include a PCR forward primer having a nucleotide sequence shown as SEQ ID No.4 (FAM-ATTGGCACTCCACGCATAGG) and a PCR reverse primer having a nucleotide sequence shown as SEQ ID No.5 ((15A) -Spacer 18-TTCACGGTAGCACGCATAGG); Preferably, in step S3, the PCR apparatus is programmed to perform PCR amplification at 95℃for 2min, 95℃for 30S, 60℃for 30S, 72℃for 30S, and cycling for 72℃for 1min, 4℃for forever, wherein the number of cycles is =the Ct value of the positive sieve solution +7.
- 8. The method according to claim 2, wherein in step S3, the centrifugation method comprises the steps of mixing the PCR amplification product with ultrapure water and n-butanol, and centrifuging; Preferably, in step S3, the method of melting is electrophoresis using 8% urea-denatured gel; preferably, in step S3, the concentration method comprises the steps of mixing the melting product with n-butanol, and removing the supernatant after delamination.
- 9. A kit for detecting gossypol, which is characterized by comprising the nucleic acid aptamer of claim 1 or the nucleic acid aptamer obtained by the screening method of any one of claims 2-8.
- 10. Use of a nucleic acid aptamer according to claim 1 or obtained by a screening method according to any one of claims 2 to 8 for detecting gossypol.
Description
Gossypol specific nucleic acid aptamer and preparation method and application thereof Technical Field The invention belongs to the technical field of biology, and particularly relates to a gossypol specific nucleic acid aptamer, a preparation method and application thereof. Background Gossypol (Gossypol) is a naturally occurring naphthalene aldehyde polyphenol compound in cotton seeds of the genus gossypium of the family malvaceae, and active aldehyde groups and hydroxyl groups in the molecular structure are both cores of chemical characteristics and sources of strong biotoxicity. The cotton seed oil is used as one of important vegetable oil products in China, and gossypol contained in cotton seeds as a processing raw material remains in finished oil along with the oil preparation process, wherein the gossypol is easy to combine with trace protein in grease to form combined gossypol due to the fact that protein, fatty acid, pigment and other components are contained in cotton seed oil matrix, and meanwhile, part of free gossypol is dissolved in the grease to form a complex system of coexistence of free state and combined state. The long-term intake of the cotton seed oil with the gossypol exceeding the standard by the human body can cause damage to organs such as heart, liver, kidney and the like, and cause abnormal functions of a reproductive system when serious, thereby forming a great threat to the safety of edible oil. The national standard vegetable oil (GB 2716-2018) for food safety in China clearly shows that the limit of the vegetable oil is less than or equal to 200mg/kg, but in actual production circulation, the out-of-standard product is still detected at high frequency due to the lack of an efficient detection means, so that the urgent requirement of a special detection technology for gossypol in cottonseed oil is highlighted. Especially, the products of small processing enterprises are difficult to realize the instant quality control before delivery due to the lack of a rapid detection means, and basic supervision departments cannot develop high-efficiency screening in a circulation link due to the limitation of the existing detection technology, so that risk oil products flow into the market, and the urgent requirements of special detection technologies for gossypol in cottonseed oil are highlighted. Currently, three main-stream gossypol detection technologies are high performance liquid chromatography, simple chemical method and immunodetection method, but all have the limitation that is difficult to avoid: Although High Performance Liquid Chromatography (HPLC) can accurately quantify, complex sample pretreatment is relied on (single sample takes 1-2 hours), professional instruments and personnel are required to operate, and the on-site instant detection requirement cannot be met; the simple chemical method is simple and convenient to operate, but the detection precision is extremely low, and the accurate quantitative standard is difficult to reach, and even if the gossypol removal is finished, the verification effect of other methods is still needed, so that the process complexity and the cost are further increased; the immunodetection method is an ideal choice for primary screening of batch samples by virtue of antigen-antibody specific binding advantages, but is limited by antibody defects, namely, the preparation period is as long as 2-3 months, the storage stability at 4 ℃ is only 6 months, the immunodetection method is easy to cross-react with structural analogues, and the long-term use cost is high, so that the stability and the economy of detection results are difficult to be compatible. To break through the bottleneck of the prior art, it is critical to find new molecular recognition elements for replacement antibodies, and nucleic acid aptamers (single-stranded oligonucleotides called "chemical antibodies") offer exactly the ideal solution. The antibody is obtained through exponential enrichment ligand system evolution (SELEX) screening, has the target specific binding capacity equivalent to that of an antibody, has the incomparable advantages of the antibody, can recognize various targets such as proteins, small molecular compounds, cells and the like, has stable chemical properties and is not easy to denature, supports the modification of various groups such as fluorescein, nano materials and the like, can be prepared in batches through chemical synthesis, and has the cost of only 1/10 of that of the antibody and no immunogenicity. However, conventional SELEX screening for gossypol still faces two major bottlenecks, namely, the gossypol is used as a small molecular target (molecular mass 518 Da), active aldehyde groups/hydroxyl sites are directly fixed and are easy to cover, so that the screened aptamer cannot identify natural gossypol, and proteins and fatty acids in a cotton seed oil matrix are easy to be combined with library sequences in a non-specific manner, so that the enri