CN-122012523-A - Rice OsCOI a mutant gene, protein and application thereof

Abstract

The invention relates to the technical field of agriculture, in particular to a rice OsCOI a mutant gene, protein and application thereof. The invention provides a rice OsCOI a mutant gene, the nucleotide sequence of the rice OsCOI a mutant gene is that the wild rice OsCOI a gene has mutation from C to A at the 308 th position of the nucleotide sequence. The rice OsCOI a mutant gene provided by the invention is that the wild rice OsCOI a gene is mutated from C to A at the 308 th site of the nucleotide sequence, so that alanine at the 103 rd site of the OsCOI a protein amino acid sequence is mutated into aspartic acid, the rice mutant gene or mutant protein can not only improve the brown planthopper resistance of rice, but also enhance the high-temperature tolerance of rice, the growth and the yield of rice are not obviously affected, and the rice mutant gene or mutant protein has great production and application values.

Inventors

• ZHANG XIAO
• LI JUAN
• GU DONGFANG
• QIN RUIYING
• XU RONGFANG

Assignees

• 安徽省农业科学院水稻研究所

Dates

Publication Date

20260512

Application Date

20260210

Claims (10)

1. 1. A rice OsCOI a mutant gene is characterized in that the nucleotide sequence of the rice OsCOI a mutant gene is that the wild type rice OsCOI a gene has mutation from C to A at the 308 th position of the nucleotide sequence.
2. 2. The rice OsCOI a mutant gene according to claim 1, wherein the nucleotide sequence of the rice OsCOI a mutant gene is shown in SEQ ID No. 1.
3. 3. A rice OsCOI a mutant protein is characterized in that the amino acid sequence of the rice OsCOI a mutant protein is that the wild rice OsCOI a protein has mutation from alanine to aspartic acid at the 103 rd position of the amino acid sequence.
4. 4. The mutant rice OsCOI a protein according to claim 3, wherein the amino acid sequence of the mutant rice protein is shown in SEQ ID NO. 2.
5. 5. A recombinant plasmid comprising the rice OsCOI a mutant gene according to claim 1 or 2.
6. 6. A plant expression vector comprising the rice OsCOI a mutant gene according to claim 1 or 2.
7. 7. A recombinant cell comprising the rice OsCOI a mutant gene of claim 1 or 2.
8. 8. A recombinant protein comprising the rice OsCOI a mutant gene according to claim 1 or 2.
9. 9. A method for obtaining a rice plant with increased brown planthopper resistance, comprising the steps of: Allowing plants to contain the rice OsCOI a mutant gene according to claim 1 or2 by gene editing, crossing, backcrossing, selfing or asexual propagation; Wherein the plant is rice.
10. 10. Use of the rice OsCOI a mutant gene according to claim 1 or 2 to increase rice high-temperature tolerance.

Description

Rice OsCOI a mutant gene, protein and application thereof Technical Field The invention relates to the technical field of agriculture, in particular to a rice OsCOI a mutant gene, protein and application thereof. Background Rice is one of the most important food crops in the world. Brown planthoppers (Brown planthopper, BPH) are a type of rice monophagic piercing insect. Brown planthoppers pierce plants through the mouth needles to absorb juice, consume plant nutrients, cause yellowing of leaves, ageing of plants and empty and shrunken seeds, and seriously affect the yield and quality of rice. In addition, brown planthoppers can also transmit rice dentate dwarf virus and grass-like plexus dwarf virus, further exacerbating the hazard. The rice self-resistance is utilized to select and plant the insect-resistant variety, which is considered to be the most effective, economical and environment-friendly brown planthopper control strategy, and the excavation and identification of the gene for resisting brown planthopper is the premise and the foundation for cultivating the insect-resistant variety. High temperature weather is one of the major abiotic stresses in rice growth and production. In the whole growth period of rice, the rice is very sensitive to high temperature, and high temperature weather can not only cause damage to rice leaves, growth resistance, pollen vitality, reduction of fruiting rate and the like, so that yield reduction of the rice is caused, but also cause abnormal grouting and increased chalkiness, and the quality of the rice is influenced. At present, rice high temperature resistant genes are still deficient. Therefore, the identification of the high-temperature-resistant excellent gene of the rice is of great importance, and has great significance for guaranteeing the grain safety. The gene editing technology is a revolutionary tool in life science research and crop breeding, can rapidly and efficiently accurately edit target genes and target sites, realizes the accurate improvement of target characters, greatly improves the efficiency of germplasm creation and variety breeding, and obviously reduces the time and labor cost. Disclosure of Invention In order to solve the technical problems, the invention provides a rice mutant gene and protein with brown planthopper resistance and application thereof. The rice OsCOI a mutant gene is that the wild rice OsCOI a gene is mutated from C to A at the 308 th site of the nucleotide sequence, and the rice mutant gene not only can improve the brown planthopper resistance of rice, but also can enhance the high-temperature tolerance of rice, and the rice growth and yield are not obviously affected, so that the rice has great production and application values. Therefore, the invention provides the following technical proposal, In a first aspect, the present invention provides in an alternative embodiment a rice OsCOI a mutant gene whose nucleotide sequence is that of wild-type rice OsCOI a gene, the mutation from C to a occurring at position 308 of the nucleotide sequence is the rice OsCOI a mutant gene. Preferably, the nucleotide sequence of the rice OsCOI a mutant gene is shown as SEQ ID NO. 1. The nucleotide sequence of the wild rice OsCOI a gene is shown as SEQ ID NO. 3. In a second aspect, the present invention provides in an alternative embodiment a rice OsCOI a mutant protein having the amino acid sequence of OsCOI a mutant protein of wild type rice OsCOI a having a mutation from alanine to aspartic acid at position 103 of the amino acid sequence. Preferably, the amino acid sequence of the rice mutant protein is shown as SEQ ID NO. 2. The amino acid sequence of the wild rice OsCOI a protein is shown as SEQ ID NO. 4. In a third aspect, the present invention provides in an alternative embodiment a recombinant plasmid comprising the above rice OsCOI a mutant gene. In a fourth aspect, the present invention provides in an alternative embodiment a plant expression vector comprising the above rice OsCOI a mutant gene. In a fifth aspect, the present invention provides, in an alternative embodiment, a recombinant cell comprising a rice OsCOI a mutant gene as described above. In a sixth aspect, the present invention provides, in an alternative embodiment, a recombinant protein comprising the above rice OsCOI a mutant gene. In a seventh aspect, the present invention provides in an alternative embodiment a method of obtaining a rice plant with increased resistance to brown planthopper comprising the steps of: The plants contain the rice OsCOI a mutant gene by a method of gene editing, hybridization, backcrossing, selfing or asexual propagation; Wherein the plant is rice. In an eighth aspect, the present invention provides in an alternative embodiment the use of a rice OsCOI a mutant gene as described above for increasing the high temperature tolerance of rice. The nucleotide sequence of SEQ ID NO.1 is shown as follows: ATGGGTGGCGAGGTGCCGGAGCCGCGGCGGCTCAACCG