Search

CN-122012537-A - Gene GbCYP A6 for promoting synthesis of ginkgolide and application thereof

CN122012537ACN 122012537 ACN122012537 ACN 122012537ACN-122012537-A

Abstract

The invention discloses a gene GbCYP A6 for promoting the synthesis of ginkgolide and application thereof, wherein the nucleotide sequence of the gene GbCYP A6 is shown as SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown as SEQ ID NO. 2. The invention clones from ginkgo to a brand new gene GbCYP A701A 6 for the first time. By transferring GbCYP A6 gene into ginkgo body, over-expressing GbCYP A6 gene, terpene lactones in ginkgo including ginkgolide A, ginkgolide B, ginkgolide C and bilobalide content are obviously increased, and silencing expression of the gene, ginkgolide A, B, C and bilobalide content are obviously reduced, which shows that the gene is a key gene for promoting synthesis of ginkgolide, thus regulating GbCYP A6 expression has important application value in improving medicinal quality of ginkgo leaves and the like.

Inventors

  • LU ZHAOGENG
  • ZHU LING
  • ZHU LIKUI
  • REN SHIXIONG
  • CUI JIAWEN
  • LU JINKAI
  • WANG LI
  • JIN BIAO

Assignees

  • 扬州大学

Dates

Publication Date
20260512
Application Date
20260129

Claims (10)

  1. 1. A gene GbCYP A6 for promoting synthesis of ginkgolide is characterized in that the nucleotide sequence of the gene GbCYP A6 is shown in SEQ ID NO. 1.
  2. 2. A protein expressed by a gene GbCYP A6 for promoting the synthesis of ginkgolide according to claim 1, wherein the amino acid sequence of the protein is shown in SEQ ID No. 2.
  3. 3. An expression vector comprising the gene GbCYP A6 for promoting the synthesis of ginkgolide according to claim 1.
  4. 4. The expression vector according to claim 3, wherein the primer pair used for amplifying the gene GbCYP A6 to construct the over-expression vector p1305.4 is preferably SEQ ID NO.3: ATGACAAAGCTTCTGTTAGCCACTAT and SEQ ID NO.4: ATGGTTAGTTGCAGAGGATCTTCTG.
  5. 5. A host bacterium comprising the gene GbCYP A6 for promoting the synthesis of ginkgolide according to claim 1 or the expression vector according to claim 3.
  6. 6. Use of the gene GbCYP A6 according to claim 1 or the protein according to claim 2 or the expression vector according to claim 3 or the host bacterium according to claim 5 for promoting the synthesis of ginkgolide.
  7. 7. The use according to claim 6, wherein the terpene lactone is any one or more of ginkgolide a, ginkgolide B, ginkgolide C and bilobalide.
  8. 8. The use according to claim 6, wherein the gene GbCYP A6 is overexpressed in ginkgo in promoting the synthesis of ginkgolide.
  9. 9. The application of the ginkgo terpene lactone synthesis promoter according to claim 6, wherein the ginkgo terpene lactone synthesis promoter is characterized in that ginkgo leaves are used as materials, a gene GbCYP A6 is cloned, the gene is constructed on an over-expression vector p1305.4, a recombinant vector is obtained by construction, the recombinant vector is transformed into agrobacterium, and the agrobacterium suspension is injected into the ginkgo leaves for carrying out the original genetic transformation, and under the drive of a promoter CaMV35S, the GbCYP701A6 can be efficiently expressed in a ginkgo body, so that the terpene lactone synthesis promoter is used for promoting the terpene lactone synthesis.
  10. 10. Use of the gene GbCYP A6 according to claim 1 or the protein according to claim 2 or the expression vector according to claim 3 or the host bacterium according to claim 5 for culturing ginkgo with high ginkgolide content.

Description

Gene GbCYP A6 for promoting synthesis of ginkgolide and application thereof Technical Field The invention belongs to the technical field of molecular biology, and particularly relates to a gene GbCYP A701A 6 for promoting synthesis of ginkgolide and application thereof. Background Ginkgo biloba (Ginkgo biloba L.) is the only existing species of Ginkgo genus of Ginkgoaceae family, and as ancient wiggley plant, its leaves are rich in multiple bioactive components such as flavonoids, terpenes, phenolic acids, and bilobalide, and have important medicinal and economic values. The ginkgo extract (Ginkgo biloba Extract, gbE) is an effective component extracted from ginkgo leaves, mainly comprises flavonols and terpene internal lipid compounds, and is an important medicinal raw material for treating cardiovascular diseases. The ginkgolide is an active substance specific to semen Ginkgo, and can be classified into diterpene ginkgolide (ginkgolides, A/B/C/J/M, etc.) and sesquiterpene bilobalide (bilobalide, BB). Ginkgolide is a specific Platelet Activating Factor (PAF) antagonist and has remarkable pharmacological activity in the aspects of neuroprotection, antiallergic, treatment of cardiovascular and cerebrovascular diseases and the like, so that the content of ginkgolide in ginkgo leaves directly influences the quality and medicinal value of raw materials. However, the chemical structure of ginkgolides is highly complex, and contains unique structural units such as a twelve-carbon skeleton structure, a plurality of lactone rings, tertiary butyl groups and the like, so that the total chemical synthesis of ginkgolides is extremely difficult. At present, the biosynthesis pathway and key enzyme genes are not clear, which further restricts the realization of efficient production through synthetic biological strategies. In addition, the natural content of ginkgo leaves is very low (generally only accounting for 0.01% -0.1% of dry weight), and is influenced by varieties, tree ages, ecological environment and harvesting period, the yield is unstable, and the market demand is difficult to meet. Therefore, analyzing the biosynthesis way of ginkgolide, exploring and verifying the key synthetic gene thereof has become a key scientific problem for improving the yield of ginkgolide and promoting the development of related industries. The biosynthesis of ginkgolide follows the plant isoprene metabolic pathway. The upstream is formed by general enzyme system, after geranylgeranyl pyrophosphate (GGPP), it is cyclized by terpene synthase to form a characteristic skeleton, and then it is converted into final product with biological activity by multi-step oxidative modification. In this process, the cytochrome P450 monooxygenase (CYP 450) superfamily plays a central role and is responsible for carrying out key reactions such as hydroxylation, epoxidation, oxidative rearrangement and the like, and influences the structural diversity, oxidative modification degree and biological activity of terpenoids. The ginkgo gene functional research is slow due to the fact that the ginkgo genome is huge, the growth cycle is long, the genetic transformation system is still immature. Therefore, the key CYP450 enzyme in the synthesis path of the ginkgolide is deeply excavated and functionally verified, so that the key blank of the secondary metabolism path of the ginkgolide can be filled, the molecular basis formed by the unique medicinal components of the key CYP450 enzyme is revealed, and important gene resources can be provided for improving the yield of the ginkgolide through the technology of synthetic biology and metabolic engineering. Disclosure of Invention Aiming at the defects existing in the prior art, the invention provides the key gene GbCYP A6 for promoting the synthesis of the ginkgolide, and the contents of the ginkgolide A, the ginkgolide B, the ginkgolide C and the bilobalide in the ginkgo can be simultaneously improved by promoting the expression of the gene, so that the synthesis of the terpene lactones in the ginkgo is effectively improved. The invention also provides a protein and a vector expressed by the key gene GbCYP A6 for promoting the synthesis of the ginkgolide and application thereof. The invention also establishes a gingko original transient over-expression and gene silencing technical system, and provides a reliable technical method for analyzing the functions of gingko genes. According to the technical scheme, in order to achieve the purpose, the gene GbCYP A6 for promoting the synthesis of the ginkgolide disclosed by the invention has the nucleotide sequence of the gene GbCYP A6 shown in SEQ ID NO. 1. The protein expressed by the gene GbCYP A6 for promoting the synthesis of the ginkgolide is shown as SEQ ID NO. 2. The invention relates to an expression vector containing gene GbCYP A6 for promoting the synthesis of ginkgolide. Preferably, the expression vector is assembled with a constitutive promoter CaMV35S at the