CN-122012543-A - CsBCH1 gene for regulating formation of cucumber pale yellow petals, inDel marker and application thereof
Abstract
The invention provides CsBCH genes for regulating and controlling the formation of cucumber pale yellow petals, inDel markers and application thereof, wherein the CsBCH genes are key genes for regulating and controlling the formation of cucumber pale yellow petals, the functions relate to petal carotenoid metabolism, and a new target is provided for the research of cucurbitaceae flower colors. The co-dominant InDel marker in the gene can directly and accurately distinguish homozygous wild type, homozygous mutant type and heterozygous type, and the detection method only needs conventional PCR and electrophoresis, is simple, convenient and quick, and has low cost.
Inventors
- CAO MINGMING
- YANG RUIHUAN
- WANG HUIZHE
- DENG QIANG
Assignees
- 天津市农业科学院
Dates
- Publication Date
- 20260512
- Application Date
- 20260326
Claims (10)
- 1. A gene CsBCH for regulating formation of cucumber pale yellow petals is characterized in that the sequence of a CsBCH gene coding region is shown as SEQ ID NO.1 or SEQ ID NO. 2.
- 2. An InDel molecular marker for identifying the CsBCH genotype of claim 1, wherein said InDel molecular marker corresponds to a TT double base insertion/deletion on exon 1 of the CsBCH gene coding region.
- 3. A primer pair for amplifying the InDel molecular marker of claim 2, wherein the nucleotide sequence of the primer pair is shown as SEQ ID No.3 and SEQ ID No. 4.
- 4. A kit for identifying the colour genotype of cucumber petals, characterized in that it comprises the primer pair of claim 3.
- 5. Use of the gene CsBCH of claim 1, the InDel molecular marker of claim 2 or the primer of claim 3, including but not limited to any of the following: (1) Identifying the color phenotype of cucumber petals; (2) Screening and evaluating petal color related genotypes of cucumber germplasm resources; (3) Auxiliary breeding of cucumber varieties with specific petal colors.
- 6. A method for identifying the color genotype of cucumber petals, comprising detecting the insertion/deletion status of the CsBCH-InDel marker of claim 2 in the cucumber genome.
- 7. The method of claim 6, comprising the steps of: (1) Extracting genome DNA of a cucumber sample to be detected; (2) Performing PCR amplification using the primer set of claim 3 using the genomic DNA obtained in step (1) as a template; (3) And (3) carrying out electrophoretic separation on the PCR product obtained in the step (2), and judging CsBCH genotypes according to the sizes of amplified fragments.
- 8. The method of claim 7, wherein in step (3): if the single 66 bp band consistent with the pale yellow petal parent TJ8-3 is amplified, the homozygous genotype of the pale yellow petals of the cucumber is judged; if a single band of 64 bp is amplified, judging that the yellow petals are homozygous in genotype; if both bands 64 bp and 66 bp are amplified simultaneously, the heterozygous genotype is determined.
- 9. The method of claim 7, wherein the step of determining the position of the probe is performed, The PCR reaction system comprises 0.8 mu L of 10 mu M forward and reverse primers, 2 mu L of template DNA, 2X Taq PCR MasterMix mu L and 6.4 mu L of ddH 2 O; The PCR procedure was 94℃for 5 min, 94℃for 30 s,53℃for 30 s,72℃for 30 s cycles, and finally 72℃for 5 min.
- 10. Use of CsBCH gene according to claim 1 for regulating colour of cucumber petals by means of gene editing, transgene or molecular marker assisted selection technique.
Description
CsBCH1 gene for regulating formation of cucumber pale yellow petals, inDel marker and application thereof Technical Field The invention belongs to the technical field of plant molecular genetic breeding, and particularly relates to CsBCH gene for regulating formation of cucumber pale yellow petals, inDel molecular markers developed based on the gene, a related primer pair and application thereof in color identification and auxiliary breeding of the cucumber petals. Background Cucumber (culumis sativus l.) is an important vegetable crop of cucurbitaceae, and its fruit is crisp and tasty, and is nutritious, and is deeply favored by consumers. The petal color is used as an important character and a main visual signal of a plant, plays a key role in the plant propagation process, directly influences the flower visiting preference and efficiency of pollinating insects, and further influences the pollination efficiency and the fruit and seed yield. Generally, cucumber petals are yellow, and the petals gradually lighten along with the extension of flowering time. At present, the research on molecular genetic mechanism of cucumber petal color formation is few, and the lack of practical molecular markers for breeding restricts the directional improvement of the character. The inventors found that one part of the cucumber petal color mutant material TJ8-3, the petals thereof appeared to be stable pale yellow throughout the entire period of fertility, while the wild type control TJ8-11-1 appeared to be normally yellow. Genetic analysis shows that the pale yellow petal character is monogenic recessive inheritance. The present inventors have conducted intensive studies in order to clone a gene controlling the trait and develop a marker useful for molecular breeding. Disclosure of Invention The invention aims to provide CsBCH gene for regulating formation of cucumber pale yellow petals, a molecular marker developed based on key mutation sites of the gene and a specific primer pair thereof, and application of the gene in quick identification of cucumber petal colors and molecular breeding. In order to achieve the above purpose, the invention adopts the following technical scheme: In a first aspect, the invention provides a CsBCH gene for regulating and controlling cucumber pale yellow petal formation, said gene is positioned on chromosome 5 of cucumber reference genome clv4.0, and the gene annotation number is CsaV4_5g000248, and the gene encodes beta-carotene 3-hydroxylase. The gene has a 2 bp InDel locus in the coding region. The CDS sequence of the yellow petals CsBCH gene coding region (CDS) is shown as SEQ ID NO.1, and the CDS sequence of the pale yellow petals is shown as SEQ ID NO. 2. SEQ ID NO.1:ATGACGACGGTGATTTCGGCCGTTGCAACCGCCGGGCCGTACCGGTATGATTACGGGAGGTTGTTTCAACGCCCGGCCGCCGGAGCTCCGAGTCCAGGTTTTCCATGGCGGTGTTTTGCGAAACAGAGGTGGAGAAGGAGAAGATTGATGGTTGTGAAGATGAAGAAGAAGAAAAGTGAAGAAGATGAAATGGTTAAGGAATTGAAAATGAGTGTGGAGGAGAAAATGGGGAAGAAGAAAGCAGAAAGAGAGGGTTATTTGATAGCTGCAATTGTTTCGAGCTTTGGGATCACTTCAATGGCCGCCATCGCTGTTTATTACCGTTTCTCTTCCCAAATAATGGAGGGCGGAGAATTTCCACTTTTAGAAATGTTCGGCACTTTTGTACTATCTATTGGTTCTGCTGTGGGCATGGAATTTTGGGCGAGATGGGCTCACAAAGAGCTATGGCATGCTTCGTTATGGGATATGCATGAGTCTCATCACAAGCCGAGGGTTGGAGCATTTGAAAAGAACGATGTGTTTGCAATTATAAACGCGATTCCAGCCATTGCTCTTCTTTCTTTCGGCCTCTTCAATCAAGGCTTCTTTCCCGGCCTTTGTTTTGGTGCCGGTTTGGGAATTACGGTGTTTGGGATGGCCTACATGTTCGTCCACGATGGCCTCGTTCACCGTCGTTTCCCCGTGGGTCCGATAGCCGCTGTCCCCTACTTACGACGTGTCGCTGCTGCTCATCATATCCATCATACGGATAAATTTGACGGAGTTCCATATGGGTTGTTTTTAGGACCCAAGGAACTGGAAGAAGTGGATGGCGAGGAAGAGCTGCAGAAGGAAATTAGGAGGAGAAAGGTTTACAGAAATTAA. SEQ ID NO.2:ATGACGACGGTGATTTCGGCCGTTGCAACCGCCGGGCCGTACCGGTATGATTACGGGAGGTTGTTTCAACGCCCGGCCGCCGGAGCTCCGAGTCCAGGTTTTTTCCATGGCGGTGTTTTGCGAAACAGAGGTGGAGAAGGAGAAGATTGATGGTTGTGAAGATGAAGAAGAAGAAAAGTGAAGAAGATGAAATGGTTAAGGAATTGAAAATGAGTGTGGAGGAGAAAATGGGGAAGAAGAAAGCAGAAAGAGAGGGTTATTTGATAGCTGCAATTGTTTCGAGCTTTGGGATCACTTCAATGGCCGCCATCGCTGTTTATTACCGTTTCTCTTCCCAAATAATGGAGGGCGGAGAATTTCCACTTTTAGAAATGTTCGGCACTTTTGTACTATCTATTGGTTCTGCTGTGGGCATGGAATTTTGGGCGAGATGGGCTCACAAAGAGCTATGGCATGCTTCGTTATGGGATATGCATGAGTCTCATCACAAGCCGAGGGTTGGAGCATTTGAAAAGAACGATGTGTTTGCAATTATAAACGCGATTCCAGCCATTGCTCTTCTTTCTTTCGGCCTCTTCAATCAAGGCTTCTTTCCCGGCCTTTGTTTTGGTGCCGGTTTGGGAATTACGGTGTTTGGGATGGCCTACATGTTCGTCCACGATGGCCTCGTTCACCGTCGTTTCCCCGTGGGTCCGATAGCCGCTGTCCCCTACTTACGACGTGTCGCTGCTGCTCATCATATCCATCATACGGATAAATTTGACGGAGTTCCATATGGGTTGTTTTTAGGACCCAAGGAACTGGAAGAAGTGGATGGCGAGGAAGAGCTGCAGAAGGAAATTAGGAGGAGAAAGGTTTACAGAAATTAA. In a second aspect, the invention provides an InDel molecular marker for identifying CsBCH A genotype, designated CsBCH1-InDel. The marker corresponds to the 2 bp InDel site of the coding region of the gene, in particular, the InDel molecular marker corresponds to TT double-base insertion/deletion on exon 1 of the CsBCH gene coding region. In a third aspect, the invention provides a specific primer pair for amplifying the CsBCH1-InDel molecular markers, the nucleotide sequence of which is as follows: Forw