CN-122012563-A - Recombinant vector, genetically engineered rhizobium and application thereof in improving heat resistance of leguminous plants
Abstract
The invention relates to a recombinant vector, genetically engineered rhizobia and application thereof in improving heat resistance of leguminous plants. The recombinant vector contains a heat-induced promoter PkatC and a cytokinin synthesis gene ipt, the nucleotide sequence of the heat-induced promoter PkatC is shown as SEQ ID NO.1, and the nucleotide sequence of the cytokinin synthesis gene ipt is shown as SEQ ID NO. 2. The method comprises the steps of transferring a recombinant vector pSRK-PkatC-ipt containing a heat-induced promoter PkatC and a cytokinin synthetic gene ipt into sinorhizobium meliloti to construct and obtain genetic engineering rhizobium, and inoculating the engineering rhizobium to alfalfa plants to strengthen high-temperature resistance of the alfalfa plants. Compared with the prior art, the engineering bacteria constructed by the invention can effectively improve the survival and growth capacity of alfalfa under a high-temperature environment, and experimental results provide reliable technical support for cultivating new varieties of stress-resistant alfalfa and stable yield of ecological agriculture, and have important application value.
Inventors
- LUO LI
- YU HUILIN
- YU KEXIN
- YU LIANGLIANG
Assignees
- 上海大学
Dates
- Publication Date
- 20260512
- Application Date
- 20260108
Claims (10)
- 1. A recombinant vector containing a heat-induced promoter PkatC and a cytokinin synthesis gene ipt is characterized in that the nucleotide sequence of the heat-induced promoter PkatC is shown as SEQ ID NO.1, and the nucleotide sequence of the cytokinin synthesis gene ipt is shown as SEQ ID NO. 2.
- 2. The recombinant vector comprising the heat-inducible promoter PkatC and the cytokinin synthesis gene ipt according to claim 1, wherein the vector backbone of the recombinant vector comprising the heat-inducible promoter PkatC and the cytokinin synthesis gene ipt is selected as a pSRK-Km empty vector.
- 3. A method for constructing a recombinant vector comprising a heat-inducible promoter PkatC and a cytokinin synthesis gene ipt according to claim 1 or 2, comprising the steps of: 1) PCR amplification and purification of the target gene fragment: Respectively carrying out high-fidelity PCR amplification by using a template containing PkatC and ipt genes and using a primer to obtain PkatC fragments and ipt fragments; 2) Linearization and purification of the vector: Double-restriction enzyme digestion is carried out on pSRK-Km plasmid by using Kpn I and Nhe I restriction enzymes, so that the plasmid is linearized and a tail end compatible with the tail end of the target fragment is generated; 3) Construction of recombinant plasmids: After the amplified products are verified by agarose gel electrophoresis, the amplified products are purified by using SanPrep column type DNA gel recovery kit, and the purified PkatC fragment and ipt fragment are cloned to the multiple cloning sites of the pSRK-Km plasmid in sequence by a restriction enzyme method, so that a group vector, namely the recombinant plasmid pSRK-PkatC-ipt, is constructed.
- 4. A genetically engineered rhizobia comprising a thermally-inducible promoter PkatC and a cytokinin-synthesizing gene ipt, wherein said genetically engineered rhizobia comprises the recombinant vector of claim 1 or 2.
- 5. The genetically engineered rhizobium containing a thermally inducible promoter PkatC and a cytokinin synthesizing gene ipt of claim 4, wherein the genetically engineered rhizobium is sinorhizobium meliloti (Sinorhizobium meliloti).
- 6. Use of the recombinant vector comprising the heat-inducible promoter PkatC and the cytokinin synthesis gene ipt of claim 1 or 2, the genetically engineered rhizobia of claim 4 or 5 for improving heat resistance of leguminous plants.
- 7. The use according to claim 6, wherein the heat resistance is enhanced by inoculating a genetically engineered rhizobium containing a heat-inducible promoter PkatC and a cytokinin synthase gene ipt to leguminous plants.
- 8. The use according to claim 6, wherein the recombinant vector containing the heat-inducible promoter PkatC and cytokinin synthesis gene ipt, the genetically engineered rhizobium is capable of alleviating the growth inhibition of leguminous plants by high temperature stress.
- 9. The use according to claim 6, wherein the leguminous plant is alfalfa.
- 10. The use according to claim 6, wherein the method of inoculating genetically engineered rhizobia into leguminous plants comprises: Inoculating the genetically engineered rhizobia into an LB/MC liquid culture medium, shake culturing by a shaking table until the OD value is 1.0, centrifuging to precipitate thalli, re-suspending the thalli by using normal saline, diluting to obtain a bacterial liquid containing the genetically engineered rhizobia, and inoculating the bacterial liquid containing the genetically engineered rhizobia after the leguminous plant seedlings grow.
Description
Recombinant vector, genetically engineered rhizobium and application thereof in improving heat resistance of leguminous plants Technical Field The invention relates to the technical field of plant genetic engineering, in particular to a recombinant vector, genetically engineered rhizobium and application thereof in improving heat resistance of leguminous plants. Background The extremely high Wen Tianqi frequency caused by global warming constitutes a serious threat to agricultural production. Leguminous plants are used as important feed crops and ecological restoration species, and the growth and nitrogen fixation capacity of the leguminous plants can be obviously inhibited under high-temperature stress, so that the yield is reduced and the ecological function is damaged. At present, main measures for coping with high temperature stress include breeding heat-resistant varieties and improving agronomic management, but the methods have long period, high cost or limited effect. Sinorhizobium meliloti (Sinorhizobium meliloti) and alfalfa are symbiotic nitrogen fixation and are important supports for alfalfa growth. The rhizobia is modified by genetic engineering technology, so that the rhizobia activates stress-resistant physiological response of plants at high temperature, and a new thought is provided for enhancing heat resistance of alfalfa. For example, chinese patent CN114381408a discloses rhizobium fava with drought tolerance and its use. The isolated strain of the rhizobium fava with drought resistance is obtained from a broad bean host, and is subjected to morphological, physicochemical and whole genome analysis identification, and belongs to a new strain of the genus rhizobium of the family rhizobiaceae of the genus rhizobium of the kingdom of bacteria, the phylum of Proteobacteria, and the microorganism preservation number is CGMCC No.24092. The rhizobia of the broad beans has the characteristics of drought resistance, high-efficiency nodulation, strong nitrogen fixation capacity and the like, and the inoculation of the rhizobia of the broad beans can effectively improve the drought resistance of the broad beans, increase the biomass and the yield of the broad beans, and has application prospects in the aspects of improving the stress resistance of leguminous crops, promoting the growth, improving the yield and the like. Chinese patent CN117844829B discloses application of soybean heat-resistant protein GmBSK1 and encoding gene thereof in regulating plant stress resistance, the application provides application of GmBSK protein and related biological materials thereof in regulating plant stress resistance, and the GmBSK protein is protein with an amino acid sequence of SEQ ID No. 1. The coding gene of GmBSK protein is introduced into a receptor plant to obtain an over-expression plant of the over-expression GmBSK gene, and under the condition of high temperature stress, the survival rate of the over-expression plant is obviously higher than that of a receptor control, which shows that the GmBSK gene can obviously improve the high temperature stress resistance of the plant. The gene for regulating and controlling plant stress resistance can be used for cultivating new plant stress resistance varieties. However, the current technology of specifically enhancing abiotic stress resistance of host plants using engineered rhizobia is still immature and lacks efficient, targeted solutions. Disclosure of Invention In order to cope with the challenge of high temperature stress to the growth of leguminous plants, the invention provides a recombinant vector, genetically engineered rhizobium and application thereof in improving the heat resistance of leguminous plants, aiming at the problem of growth inhibition of leguminous plants (especially alfalfa) in a high-temperature environment. The application obtains a recombinant vector containing a heat-induced promoter PkatC and a cytokinin synthesis gene ipt and a genetic engineering rhizobia based on the functional combination of the heat-induced promoter PkatC and the cytokinin synthesis gene ipt, and utilizes the genetic engineering rhizobia to improve the heat resistance of leguminous plants. The scheme of the application provides a new biological technical means for stress-resistant cultivation (heat resistance) of leguminous plants (especially alfalfa). The aim of the invention can be achieved by the following technical scheme: The invention firstly provides a recombinant vector containing a heat-induced promoter PkatC and a cytokinin synthesis gene ipt, wherein the nucleotide sequence of the heat-induced promoter PkatC is shown as SEQ ID NO.1, and the nucleotide sequence of the cytokinin synthesis gene ipt is shown as SEQ ID NO. 2. Specifically, the nucleotide sequence of the heat-inducible promoter PkatC is specifically as follows: TCCGAAGCTCCTAACGGCGTGCCTCCCGACGGCGCCGAGCGCTATTGGCGTTTCCGTCCACGCCGCATCGTCTGGCGCGCCGACGCGCTACCAATCCGCTACGAACTAAAATCATCGTGATCTGGTGGTC