Search

CN-122012592-A - Application of LOC_Os03g28130 gene in rice trait prediction

CN122012592ACN 122012592 ACN122012592 ACN 122012592ACN-122012592-A

Abstract

The invention relates to the field of agriculture, in particular to application of LOC_Os03g28130 gene in rice trait prediction. The invention provides an application of LOC_Os03g28130 gene in any of rice character prediction, rice breeding, preparation of a product for predicting rice characters and preparation of a product for rice breeding. According to the invention, through whole genome association analysis, a key candidate gene LOC_Os03g28130 for controlling the aspect ratio of rice grains is positioned, the gene codes F-box structural domain protein and is positioned on chromosome 3, LOD value of association site is 6.408, and contribution rate of the mutant is 23.65%. Further functional verification shows that the gene has key regulation and control effects on the seed character.

Inventors

  • MA GANG
  • Tang Leyao
  • Zhi Linran
  • WANG XUEGANG
  • WANG XIAOHU
  • SUN JUYING
  • DUANMU YINXI

Assignees

  • 常熟市农业科学研究所

Dates

Publication Date
20260512
Application Date
20260228

Claims (10)

  1. Use of the loc_os03g28130 gene in any of the following: (a) Predicting rice traits; (b) Selecting rice; (c) Preparing a product for predicting the rice characteristics; (d) Preparing a product for rice breeding; the LOC_Os03g28130 gene has a nucleotide sequence shown as SEQ ID NO. 1.
  2. 2. The use according to claim 1, wherein said use is obtained by knocking out the loc_os03g28130 gene.
  3. 3. The use according to claim 2, wherein knocking out the LOC_Os03g28130 gene comprises the steps of obtaining an expression vector knocking out the LOC_Os03g28130 gene, transferring the expression vector into a receptor material to obtain callus, and obtaining the rice through resistance screening, differentiation culture and seedling hardening and transplanting.
  4. 4. The use of claim 3, wherein the knockout employs a CRISPR-Cas9 system, wherein the sequence of the sgRNA is shown in SEQ ID No. 2.
  5. 5. The use according to claim 4, wherein the rice trait comprises one or more of grain length, grain width, thousand grain weight and spike length.
  6. 6. The use according to claim 5, wherein said loc_os03g28130 gene is knocked out, and said rice has a longer grain length, a narrower grain width, a greater thousand seed weight, or a longer spike length.
  7. 7. The use according to claim 6, wherein the rules for prediction of rice traits comprise: (e) If one or more base deletions of the LOC_Os03g28130 gene result in frame shift mutation, the rice has longer grain length, narrower grain width, greater thousand grain weight or longer spike length, or (F) If the 307 th base of LOC_Os03G28130 gene is inserted with a base T or a base G, the grain length of the rice is longer, the grain width is narrower, the thousand grain weight is larger or the spike length is longer.
  8. 8. The use according to claim 7, wherein the loc_os03g28130 gene in (a) is deleted from position 304 to position 308.
  9. 9. A method of predicting rice traits based on said loc_os03g28130 gene prediction in the use according to any one of claims 1 to 8; the rules of prediction include: (g) If the deletion of 304 th to 308 th positions of the LOC_Os03g28130 gene leads to frame shift mutation, the rice has longer grain length, narrower grain width, larger thousand grain weight or longer spike length, or (H) If a base T or a base G is inserted between the 307 th and 308 th bases of the LOC_Os03G28130 gene, the grain length of rice is longer, the grain width is narrower, the thousand grain weight is greater or the spike length is longer.
  10. 10. A method for rice breeding, characterized by breeding based on the loc_os03g28130 gene in the use as claimed in any one of claims 1 to 8; The breeding rules comprise: (i) Selecting and cultivating the rice deleted from 304 th to 308 th positions of LOC_Os03g28130 gene, or (J) And selecting rice with a base T or a base G inserted between the 307 th base and the 308 th base of the LOC_Os03G28130 gene for cultivation.

Description

Application of LOC_Os03g28130 gene in rice trait prediction Technical Field The invention relates to the field of agriculture, in particular to application of LOC_Os03g28130 gene in rice trait prediction. Background Along with the change of market demands, certain requirements on the quality of the rice are also provided on the premise of ensuring the yield of the rice. The rice grain type is one of important agronomic traits and plays an important role in improving the yield and quality of rice. The grain type mainly comprises grain length, grain width, length-width ratio and the like, and currently, more than 500 QTLs related to the grain type of the rice are identified through methods such as genetic mapping, association analysis, group sequencing analysis and the like, and the QTLs are distributed on 12 chromosomes of the rice, and more than 30 QTLs are cloned and functionally verified at present. Although extensive research has been conducted on rice grain-type related QTLs, grain-type traits are complex quantitative genetic traits controlled by multiple loci, and the genetic rules are still quite unclear. With the increasing perfection of genomics theory and methods and the increasing maturation of sequencing technology, more and more rice varieties have completed gene sequencing. These data provide the basis for studying the molecular mechanisms and genetic variation of rice. Disclosure of Invention In view of the above, the invention provides application of LOC_Os03g28130 gene in rice trait prediction. According to the invention, through whole genome association analysis, a key candidate gene LOC_Os03g28130 for controlling the aspect ratio of rice grains is positioned, the gene codes F-box structural domain protein (OsFBX 94), the LOD value of an association site of the gene is 6.408, and the contribution rate of the mutation to the surface is 23.65%. Further functional verification shows that the gene has key regulation and control effects on the seed character. The CRISPR/Cas9 technology is utilized to create a loss-of-function mutant of the gene, and two independent homozygous mutant strains (qLWR-1 and qLWR-2) uniformly show a phenotype of extremely significant increase in grain length and extremely significant decrease in width, so that the function of the gene is confirmed. Particularly important, qLWR-1 mutant has synergistic high yield potential of obviously increasing spike length, obviously reducing empty grain number and obviously improving thousand grain weight while improving grain type. In order to achieve the above object, the present invention provides the following technical solutions: the invention provides an application of LOC_Os03g28130 gene in any of the following: (a) Predicting rice traits; (b) Selecting rice; (c) Preparing a product for predicting the rice characteristics; (d) Preparing a product for rice breeding; the LOC_Os03g28130 gene has a nucleotide sequence shown as SEQ ID NO. 1. In some embodiments of the invention, the sequence of SEQ ID NO. 1 is ：ATGGCGTCCATGGCGGCGAGAAGTAGCAGGAAGCGCAGGAGCCCGCCGCCGCGTGGGCTCGGGGACCTCCACGACGACGTTCTGGAGCGCGTCCTGGCGCGCCTCCCGCCGGCCACCTTCTTCCGCCTCCGCGCCGTCTGCCGCCGCTGGAGCGCCGCCGCCGCGTCGCCCACGTTCCTCCGCGCCTGCGCCCGCGTCCCGTCGCGGGACCCGTGGTTCCTCATGCTCTCCGGCGCCCGCCCCCGCCCGCCGCTCGCCTTCGACGCCGCCGGCCGCTCCTGGATCCCTTGCCGCGCCGCGCCGGGCGGCAGCGACGGCGGCGCCGACGCCGCCGTCCCGGTGGCGTCGTCCGGCGGCCTCGTCCTCTACCGCGCGCCGGGCACGGGCGAGCTCCTCGTCGCGAACCCGCTCACCGGCGCGAGCCGTGCCCTCCCCTCGCCGCCGGGGGCCCACGGCGGCGCGCCGCGGCTCCACGCCATTGCCATGTACGGCTCCCCCTACCGCGTGGCGCTCTTCGCGGACGAGCTCCCCGACCTGTCCATGTCGGTGTTCGACTCGTCCAGGGGCTCGTGGGAGGGCCCTGTCGCGCTCTCCCGGAGGCCCGACGCCGCCGCGCTGCTCCCCGACGACGCGCCGTCCCAGGGCGGCGCCGACGACACGGTCTACTTCCTCAGCAAGTCCGGCGACGTGGTGGCCACCAACATGCAGCGCAGCGCGTCGAAGCAGTACTCCTCGGTGGTGGTCGCCGCGTCGTCCGACGGCGGCGACGCCGTGGCCTACTTCCTGAGCCACTCCGGCACGGTGGTCGCCTGCGACACGGCGCGCCGCACGTTCGCCGAGCTCCCCCGCATCCTCCCGGTCTACTTCGAGTACTCCATCGACGTCGTGGCCTGCGACGGCGCCGCCTACGCCGTCGTGCTGGCGGAGTACCTCGACACGGCGAGCCTGCGGGTGTGGGGGTTCGCCGGCGGCGCGTGGAGGCAGGTGGCCGCCATGCCGCCGGCCATGTCGCACGCGTTCCACGGCAAGAAGGCCGACATCAACTGCGTCGGCCACGGCGGCCGCCTCATGGTCTGCGTGAGCTCCGGCGAGGCCAACGGCTGCTTCATGTGCGACGTCGGCAGCAACCAGTGGGAGGAGCTCCCCAAGTGCGTCAATGGCGATGGAGAGGTCAACGACTTCTTGGCCGCTTTCTCCTTCGAGCCTAGGCTAGAGATTAGCGTCTAA. In some embodiments of the invention, the above-mentioned application is obtained by knocking out the loc_os03g28130 gene. In some embodiments of the present invention, the step of knocking out the LOC_Os03g28130 gene comprises the steps of obtaining an expression vector knocking out the LOC_Os03g28130 gene, transferring the expression vector into a receptor material to obtain callus, and obtaining the rice through resistance screening, differentiation culture and seedling hardening and transplanting. In some embodiments of the invention, the knockout uses a CRISPR-Cas9 system in which the sequence of the sgRNA is shown in SEQ ID NO. 2. In some embodiments of the invention, SEQ ID NO. 2 has the sequence CGACGTTCTGGAGC