Search

CN-122012611-A - DNA nanostructure carrier, DNA nano medicine and application thereof

CN122012611ACN 122012611 ACN122012611 ACN 122012611ACN-122012611-A

Abstract

The invention provides a DNA nanostructure carrier. The DNA nanostructure carrier provided by the invention has an EGFR aptamer structure and a connecting sequence for loading siRNA, and can further load a chemotherapeutic drug such as doxorubicin after loading siRNA, so that the DNA nanostructure carrier-based DNA nano drug is obtained. Through the targeting effect of siME on target gene expression knockout, the cytotoxicity of doxorubicin and the targeting of EGFR aptamer structure, the DNA nano-drug provided by the invention can effectively inhibit pancreatic cancer, in particular to inhibit the growth of ME 2-deficient pancreatic cancer cells.

Inventors

  • WANG YAZHOU
  • ZOU JIAJIA
  • CHEN LINJIE
  • QU NA

Assignees

  • 北京君全智药生物科技有限公司
  • 江苏省人民医院（南京医科大学第一附属医院）

Dates

Publication Date
20260512
Application Date
20241111

Claims (13)

  1. 1. A DNA nanostructure vector that is an octahedral DNA framework structure assembled from M13 phage genome ssDNA as a template strand (scaffold) and 144 staple strands (staples), wherein the 144 staple strands comprise the nucleotide sequences shown in SEQ ID No.1 to SEQ ID No.144, respectively.
  2. 2. The DNA nanostructure vector of claim 1, wherein 144 staple chains forming the octahedral DNA framework structure are divided into 102 unmodified staple chains and 42 functional chains, wherein one or more of the 42 functional chains further comprises an EGFR targeting aptamer sequence at the 5 'and/or 3' end of the nucleotide sequence thereof, and/or one or more of the 42 functional chains may further comprise a nucleotide sequence for linking siRNA at the 5 'and/or 3' end of the nucleotide sequence thereof.
  3. 3. The DNA nanostructure vector of claim 1 or 2, wherein one or more of the 42 functional strands further comprises an EGFR targeting aptamer sequence located 5 'or 3' of the nucleotide sequence of the functional strand; Preferably, the EGFR-targeting aptamer sequence is directly linked to the 5 'or 3' end of the nucleotide sequence of the functional strand, or indirectly linked to the 5 'or 3' end of the nucleotide sequence of the functional strand via other structures; preferably, the EGFR targeting aptamer sequence comprises the nucleotide sequence set forth in SEQ ID No. 145; more preferably, 6 of the 42 functional strands further comprise the EGFR targeting aptamer sequence at the 5 'or 3' end of its nucleotide sequence; It is particularly preferred that the 6 functional strands each comprise a nucleotide sequence shown in any one of SEQ ID NO.146 to SEQ ID NO. 151.
  4. 4. A DNA nanostructure vector according to any one of claims 1 to 3, characterized in that one or more of the 42 functional strands further comprises a nucleotide sequence for linking an siRNA, said nucleotide sequence being located at the 5 'or 3' end of the nucleotide sequence of the functional strand; preferably, the nucleotide sequence for linking an siRNA is directly linked to the 5 'or 3' end of the nucleotide sequence of the functional strand, or indirectly linked to the 5 'or 3' end of the nucleotide sequence of the functional strand via other structures; preferably, the nucleotide sequence for linking siRNA comprises the nucleotide sequence set forth in SEQ ID No. 152; More preferably, 36 functional strands of the 42 functional strands further comprise the nucleotide sequence for linking siRNA at the 5 'end or 3' end of the nucleotide sequence thereof; It is particularly preferred that the 36 functional strands each comprise the nucleotide sequence shown in any one of SEQ ID NO.153 to SEQ ID NO. 188.
  5. 5. The DNA nanostructure vector according to any one of claims 1 to 4, characterized in that it is assembled from 6 functional strands comprising an EGFR targeting aptamer sequence, 36 functional strands comprising a nucleotide sequence for linking siRNA, and the remaining 102 unmodified staple strands.
  6. 6. A method for producing a DNA nanostructure carrier according to any one of claims 1 to 5, comprising mixing the template strand and the staple strands in a cation-containing TAE buffer at a molar ratio of 1:5 to 1:20 for each staple strand, heating the resulting mixture to 75 to 95℃and then cooling to 4 to 25℃at a rate of 0.1 to 1℃per minute, and purifying the resulting product by centrifugation.
  7. 7. Use of the DNA nanostructure vector of any one of claims 1 to 5 in the manufacture of a medicament; Preferably, the drug is a targeted therapeutic drug, such as an siRNA drug, or the drug is a chemotherapeutic drug.
  8. 8. A DNA nano-drug comprising the DNA nanostructure carrier of any one of claims 1 to 5 and its loaded siRNA and/or small molecule drug.
  9. 9. The DNA nanodrug of claim 8, wherein the DNA nanodrug comprises a DNA nanostructure carrier and an siRNA loaded via a nucleotide sequence contained therein for linking the siRNA; Preferably, the siRNA comprises the nucleotide sequence set forth in SEQ ID No. 189; Further preferably, the DNA nano-drug comprises a loaded ME3 targeting siRNA, the sense strand (siME sense) and the antisense strand (siME antisense) of the siRNA preferably comprise the nucleotide sequences shown in SEQ ID NO.190 and SEQ ID NO.191, respectively, and more preferably, the sense strand (siME sense) of the siRNA comprises the nucleotide sequence shown in SEQ ID NO. 192.
  10. 10. The DNA nanomedicine according to claim 8 or 9, wherein the DNA nanomedicine comprises a DNA nanostructure carrier and a small molecule drug cross-linked into the DNA; preferably, the small molecule drug is an anthracycline small molecule drug or a platinum drug.
  11. 11. A method of preparing a DNA nanodrug according to any one of claims 8 to 10, which comprises: (1) Mixing the DNA nanostructure carrier with siRNA in a cation-containing TAE buffer solution, wherein the molar ratio of the DNA nanostructure carrier to the siRNA is 1:36-1:180, heating the obtained mixture to 35-55 ℃, then cooling to 4-25 ℃ at a speed of 0.1-0.5 ℃ per min, and purifying the obtained product by centrifugation, and/or (2) Mixing the DNA nanostructure carrier obtained in the step (1) with a micromolecule drug in a TAE buffer solution containing cations, incubating for 12-16h at room temperature, wherein the molar ratio of the DNA nanostructure carrier to the micromolecule drug is 1:5000-1:50000, and purifying the obtained product by centrifugation.
  12. 12. Use of a DNA nanodrug according to any one of claims 8 to 10 in the manufacture of a medicament for the treatment of EGFR-expressing tumors. Preferably, the EGFR-high expressing tumor is pancreatic cancer, more preferably ME2 deficient pancreatic cancer.
  13. 13. A pharmaceutical composition comprising the DNA nanostructure carrier of any one of claims 1 to 5, or the DNA nanodrug of any one of claims 8 to 10.

Description

DNA nanostructure carrier, DNA nano medicine and application thereof Technical Field The invention relates to the field of biotechnology, in particular to an octahedral DNA nanostructure carrier, a DNA nano drug loaded with siRNA and/or chemical drugs by using the carrier and application of the carrier and the DNA nano drug in disease treatment. Background Small interfering RNAs (sirnas) are a new class of drugs used to inhibit the expression of specific genes. However, naturally naked sirnas are unstable in the blood stream, typically have half-lives of only a few minutes, and only a few cell types are able to ingest naked sirnas. Therefore, how to efficiently deliver siRNA has been a major bottleneck in developing drugs for in vivo use of siRNA. DNA origami (DNA origami) is a DNA self-assembly technique based on long single-stranded template strands and a number of staple strands, which yields DNA nanoparticles of uniform size with precise geometry. DNA nanoparticles produced by DNA origami have many advantages such as stable structure, good biocompatibility, programmable and addressable, flexible design, ability to attach various functional molecules, excellent cell penetration ability, and the like. DNAorigami has been studied extensively in the biomedical field in recent years. For example, DNA nanoparticles produced by DNA origami are used as drug delivery vehicles, which can be used for linking various functional molecules in various ways, such as linking aptamer sequences to staple chains of a framework structure by solid phase synthesis, linking siRNA by base complementary pairing, linking anthracycline small molecule drugs by intercalation methods, and the like. Meanwhile, the DNA nanoparticles produced by the DNA origami are used as drug carriers, have high permeability and retention effect (enhanced permeability and retention effect; EPR effect) of nano drugs, can improve the enrichment degree of the loaded drugs in tumors, and realize targeted combined drug administration to the tumors. Several nanocarriers have been used to deliver siRNA. However, the clinical application of siRNA therapies is still hampered by limitations such as lack of tissue specificity, low drug loading efficiency, inflexible carrier design, etc. Pancreatic cancer is one of the most malignant cancers known at present, with a survival rate of only about 10% in 5 years. There are various modes of pancreatic cancer treatment, including surgery, chemotherapy, radiotherapy, molecular targeted therapy, immunotherapy, etc., but no mode of treatment has achieved an ideal therapeutic effect. In recent years, genetic sequencing techniques have gradually revealed the genetic mutation profile of pancreatic cancer. For example, about 1/3 of pancreatic cancer patients were found to carry SMAD4 mutations and homozygous deletions thereof, often accompanied by a deletion of the malate 2 (ME 2) gene, resulting in upregulation of malate 3 (ME 3) to eliminate Reactive Oxygen Species (ROS). Thus, pancreatic cancer cell bystander necrosis can be achieved by inhibiting the expression of ME 3. Therapeutic strategies based on these mechanisms are still slow to develop. Disclosure of Invention In order to solve the above technical problems, it is an object of the present invention to provide a novel DNA nanostructure carrier, which is an octahedral DNA nanostructure. It is another object of the present invention to provide a novel DNA nanomedicine obtained by loading the DNA nanostructure carrier with small interfering RNAs and/or anthracycline small molecules. The technical scheme of the invention is as follows. In a first aspect, the present invention provides a DNA nanostructure vector that is an octahedral DNA framework structure assembled from M13 phage genome ssDNA as a template strand (scaffold) and 144 staple strands (staples), wherein the 144 staple strands comprise the nucleotide sequences shown in SEQ ID No.1 to SEQ ID No.144, respectively. The nomenclature of the 144 staple chains, the nucleotide sequences contained and the numbering thereof are shown in Table 1. Table 1.144 naming of staple chain, nucleotide sequence contained and numbering thereof The template strand is M13 phage genomic ssDNA, preferably the template strand comprises the nucleotide sequence shown in SEQ ID No. 193. SEQ ID NO.193: 5'-TTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCC CTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGA