Search

CN-122012614-A - Construction method and application of H11 locus humanized ACE2 gene overexpression golden hamster model

CN122012614ACN 122012614 ACN122012614 ACN 122012614ACN-122012614-A

Abstract

The invention discloses a construction method and application of a golden hamster model for H11 locus humanized ACE2 gene overexpression, and belongs to the technical field of construction of genetic engineering animal models. According to the invention, a hormone-induced superovulation female golden hamster and a male endosome are fertilized to obtain a two-cell-stage embryo, an exogenous CRISPR-Cas9 gene modified sample is microinjected into a single two-cell-stage embryo blastomere for culture recovery and then transferred into a real pregnant pregnancy acceptor for in-vivo development, so that a construction method of a golden hamster model for over-expressing an ACE2 gene at an H11 site is obtained. The invention uses golden hamster as model background animal to construct humanized ACE2 over-expression golden hamster model at H11 site, which can be used for research of ACE2 gene mechanism and SARS-CoV-2 infection.

Inventors

  • LI JIANMIN
  • ZENG WENTAO
  • SHI AIMIN
  • ZHANG AIHUA
  • LAI YANA

Assignees

  • 南京医科大学

Dates

Publication Date
20260512
Application Date
20260109

Claims (9)

  1. 1. A construction method of a golden hamster model with humanized ACE2 gene over-expression at an H11 site is characterized by comprising the steps of co-injecting H11-sgRNA targeting the H11 site, a Cas9 functional element and S7-gH11-PB-K18-hACE donor into a two-cell embryo of the golden hamster under a red light source, and transplanting the two-cell embryo into a receptor body through embryo to obtain the golden hamster model with humanized ACE2 gene over-expression at the H11 site, wherein the target sequence of the H11-sgRNA is shown as SEQ ID NO:1, and the Cas9 functional element is Cas9 mRNA or Cas9 protein.
  2. 2. The method of construction according to claim 1, characterized in that it comprises the steps of: (1) Designing and preparing H11-sgRNA targeting the H11 site and donor DNA S7-gH11-PB-K18-hACE2 donor containing a humanized ACE2 gene; (2) Co-injecting the H11-sgRNA, cas9 functional element, and S7-gH11-PB-K18-hACE2 donor into the cytoplasm or nucleus of a two-cell embryo of a golden hamster under a red light source; (3) Transplanting the injected embryo into a recipient female mouse for inoculation to obtain F0 generation hamster, and carrying out PCR identification and sequencing; (4) Hybridizing the F0 generation hamster with a wild hamster to obtain an F1 generation hamster, and performing PCR identification and sequencing; (5) And (3) hybridizing the F1 generation heterozygote hamsters to obtain F2 generation hamsters, and performing PCR identification and sequencing to obtain a stable inheritance homozygote, namely the humanized ACE2 gene over-expression golden hamster model at the H11 site.
  3. 3. The construction method according to claim 1 or 2, wherein the method for preparing H11-sgRNA targeting H11 site comprises annealing an oligonucleotide pair specifically targeting H11 site to form double-stranded DNA, connecting to a CRISPR backbone vector with enzyme digestion linearization to construct recombinant plasmid, and synthesizing H11-sgRNA by in vitro transcription, wherein the oligonucleotide pair comprises gH11-sg1F with nucleotide sequence shown as SEQ ID NO. 2 and gH11-sg1R with nucleotide sequence shown as SEQ ID NO. 3.
  4. 4. The construction method of claim 3, wherein the CRISPR framework vector is a PUC57-sgRNA-EGFP-CRISP9 plasmid, and the construction method of the PUC57-sgRNA-EGFP-CRISP9 plasmid is as follows: (1) The PUC57 vector skeleton is obtained by cutting PUC57 with NotI/XhoI enzyme to obtain 2608bp fragment as skeleton PUC57-NX; (2) The preparation of the sgRNA-EGFP comprises the steps of synthesizing the sgRNA-EGFP sequence shown as SEQ ID NO. 10, and then, carrying out digestion by using NotI/XhoI to obtain the sgRNA-EGFP fragment; (3) The PUC57-sgRNA-EGFP-CRISP9 plasmid is obtained by carrying out homologous recombination on the PUC57-NX and the sgRNA-EGFP fragment to construct the PUC57-sgRNA-EGFP-CRISP9 plasmid.
  5. 5. The method of construction according to claim 3 or 4, wherein the specific process for preparing the H11-sgRNA targeting the H11 site comprises the steps of: (11) Performing linearization treatment on the CRISPR framework vector, namely performing enzyme digestion on the PUC57-sgRNA-EGFP-CRISP9 plasmid by using BsaI restriction enzyme, and separating and purifying by agarose gel electrophoresis to obtain a 2965bp linearization vector framework PUC57-CRISP9-B1; (12) Annealing the pair of oligonucleotides, namely annealing two complementary pairs of oligonucleotides gH11-sg1F and gH11-sg1R under the action of T4 PNK kinase to form a double-stranded DNA fragment; (13) Ligating and verifying that the annealed double-stranded DNA fragment is connected with a linearized vector skeleton PUC57-CRISP9-B1 by T4 ligase, and obtaining a correct recombinant plasmid PUC57-H11-sg1 after identification and sequencing verification; (14) In vitro transcription synthesis of H11-sgRNA by PCR amplification of the sgRNA expression cassette from recombinant plasmid PUC57-H11-SG1 using U6-F1 and SG-T7R primers, purification and synthesis of H11-sgRNA by T7 in vitro transcription system; The nucleotide sequences of the U6-F1 and SG-T7R primers are respectively shown as SEQ ID NO. 4 and SEQ ID NO. 5.
  6. 6. The method according to claim 5, wherein the annealing is performed at a temperature of 37℃for 30 minutes, 95℃for 5 minutes, and-6℃/Min to 25 ℃.
  7. 7. The construction method according to claim 1 or 2, wherein the S7-gH11-PB-K18-hACE2 donor is a donor DNA comprising a humanized ACE2 gene, and the S7-gH11-PB-K18-hACE donor is prepared by: (1) The vector skeleton is obtained by using restriction enzyme KpnI/SacI to cleave pCA-mTmG to obtain a target vector segment S7-KS1 of 2856 bp; (2) The H1Left and Right homologous recombination fragments are obtained by amplifying Left and Right homologous recombination arms H1Left and H2Right by using primers gH11-H1F/gH11-H1R, gH11-H2F/gH11-H2R, wherein the nucleotide sequences of the primers gH11-H1F, gH11-H1R, gH11-H2F, gH11-H2R are respectively shown as SEQ ID NO. 11-14; (3) Obtaining PB fragment, namely synthesizing PB fragment shown in SEQ ID NO. 15; (4) The S7-gH11-PB-mcs plasmid is obtained by carrying out homologous recombination on 4 DNA fragments of vector fragments S7-KS1, H1Left, H2Right and PB fragments to construct an H11 multiple cloning site vector, which is named as S7-gH11-PB-mcs plasmid; (5) The restriction endonuclease Not I/Sal I is used for double enzyme cutting of the S7-gH11-PB-mcs plasmid, a target vector fragment 5756 bp is obtained as a vector skeleton, and the target vector fragment is named as S7-gH11-PB-NS; (6) The K18-hACE2 fragment is obtained by cutting the pK18-hACE plasmid with HapI and Sal I to obtain 6823bp fragment K18-hACE2; (7) The S7-gH11-PB-K18-hACE2 donor plasmid is obtained by carrying out homologous recombination on the S7-gH11-PB-NS and the K18-hACE2 fragment, and constructing the S7-gH11-PB-K18-hACE donor plasmid.
  8. 8. The construction method according to claim 2, wherein the PCR identified specific primer pair comprises gH11-TF1, gH11-TR1, hACE-TF 1 and hACE-TR 1, the nucleotide sequence of gH11-TF1 is shown as SEQ ID NO. 6, the nucleotide sequence of gH11-TR1 is shown as SEQ ID NO. 7, the nucleotide sequence of hACE-TF 1 is shown as SEQ ID NO. 8, and the nucleotide sequence of hACE-TR 1 is shown as SEQ ID NO. 9.
  9. 9. Use of a golden hamster (H11-K18-hACE 2) model over-expressing the humanized ACE2 gene at the H11 site constructed by the method of any one of claims 1-8 in at least one of the following (1) - (5): (1) Research of ACE2 gene related functions and action mechanisms; (2) Researching infection mechanism of SARS-CoV-2 virus; (3) Evaluation of SARS-CoV-2 novel virus-causing strain; (4) Screening SARS-CoV-2 virus infection therapeutic medicine; (5) A vaccine for preventing SARS-CoV-2 virus infection was developed.

Description

Construction method and application of H11 locus humanized ACE2 gene overexpression golden hamster model Technical Field The invention belongs to the field of life science and biotechnology, and particularly relates to a construction method and application of a golden hamster (H11-K18-hACE 2) model with humanized ACE2 gene over-expression at an H11 site. Background Rapid spread and variation of SARS-CoV-2 presents a great challenge to human public health and medical resources, and the use of animal models to evaluate new therapies, to learn the potential of emerging viral variants to replicate and spread is important. The affinity of the common model animal mice ACE2 to SARS-CoV-2 spike protein is low, and the common model animal mice ACE2 has defects in the new crown related research. The previous replication of ba.5 variant dynamics in the mouse model produced different results, and there was a degree of controversy in the study that had two speculations, one that speculated the potentially fatal nature of ba.5 and the other that speculated that it was non-fatal. The key binding site of golden hamsters between the ACE2 receptor and SARS-CoV-2 is highly homologous to humans compared to mice and is a SARS-CoV-2 susceptible animal. Therefore, the construction of a new golden hamster model for researching SARS-CoV-2 infection mechanism and developing medicines has important significance. Disclosure of Invention Aiming at the technical problems of the background technology, the invention provides a construction method and application of a golden hamster (H11-K18-hACE 2) model with humanized ACE2 gene over-expression at an H11 site. According to the invention, through CRISPR-Cas9 technology, under a microscope with a red filter in a red light chamber, a golden hamster model with H11 locus humanized ACE2 gene over-expression is constructed by injecting H11-sgRNA, cas9 mRNA (or Cas9 Protein) and S7-gH11-PB-K18-hACE2 donor into a two-cell embryo so as to avoid early embryo development arrest. Construction embryo offspring were obtained by true pregnancy albino receptor embryo transfer and used to simulate and study SARS-CoV-2 infection. The invention aims at realizing the following technical method: In a first aspect, the invention claims a method for constructing a model for over-expressing a golden hamster (H11-K18-hACE 2) by humanizing an ACE2 gene at an H11 site, which comprises the steps of co-injecting H11-sgRNA targeting the H11 site, a Cas9 functional element and S7-gH11-PB-K18-hACE donor into a two-cell embryo of the golden hamster under a red light source, and transplanting the embryo into a receptor body to obtain the model for over-expressing the humanized ACE2 gene at the H11 site; The target sequence of the H11-sgRNA is shown as SEQ ID NO.1, and the Cas9 functional element is Cas9 mRNA or Cas9 protein. H11-sgRNA:GTGCATGATCCATACCAAATAGG(SEQ ID NO:1)。 Further, the construction method comprises the following steps: (1) Designing and preparing H11-sgRNA targeting the H11 site and donor DNA S7-gH11-PB-K18-hACE2 donor containing a humanized ACE2 gene; (2) Co-injecting the H11-sgRNA, cas9 functional element, and S7-gH11-PB-K18-hACE2 donor into the cytoplasm or nucleus of a two-cell embryo of a golden hamster under a red light source; (3) Transplanting the injected embryo into a recipient female mouse for inoculation to obtain F0 generation hamster, and carrying out PCR identification and sequencing; (4) Hybridizing the F0 generation hamster with a wild hamster to obtain an F1 generation hamster, and performing PCR identification and sequencing; (5) And (3) hybridizing the F1 generation heterozygote hamsters to obtain F2 generation hamsters, and performing PCR identification and sequencing to obtain a stable inheritance homozygote, namely the humanized ACE2 gene over-expression golden hamster model at the H11 site. Further, the method for preparing the H11-sgRNA targeting the H11 site comprises the steps of annealing an oligonucleotide pair specifically targeting the H11 site to form double-stranded DNA, connecting the double-stranded DNA to a CRISPR framework vector with enzyme digestion linearization to construct a recombinant plasmid, and synthesizing the H11-sgRNA through in vitro transcription, wherein the oligonucleotide pair comprises gH11-sg1F with a nucleotide sequence shown as SEQ ID NO. 2 and gH11-sg1R with a nucleotide sequence shown as SEQ ID NO. 3. gH11-sg1F:TAGGTGCATGATCCATACCAAAT(SEQ ID NO:2) gH11-sg1R:AAACATTTGGTATGGATCATGCA(SEQ ID NO:3)。 Furthermore, the CRISPR framework vector is a PUC57-sgRNA-EGFP-CRISP9 plasmid, and the construction method of the PUC57-sgRNA-EGFP-CRISP9 plasmid comprises the following steps: (1) The PUC57 vector skeleton is obtained by cutting PUC57 with NotI/XhoI enzyme to obtain 2608bp fragment as skeleton PUC57-NX; (2) The preparation of the sgRNA-EGFP comprises the steps of synthesizing the sgRNA-EGFP sequence shown as SEQ ID NO. 10, and then, carrying out digestion