CN-122012615-A - Construction method and application of Ace2 gene modified golden hamster model
Abstract
The invention discloses a construction method and application of an Ace2 gene modified golden hamster model, and belongs to the technical field of construction of genetic engineering animal models. According to the invention, the sgRNA of the specific targeting golden hamster Ace2 gene is prepared, the two-cell microinjection technology is utilized to precisely target the golden hamster Ace2 gene and realize gene modification, so that the genetically modified hamster is obtained. The invention uses golden hamster as model background animal to construct SARS-CoV-2 research application tool mouse, and constructs Ace2 deletion golden hamster model for novel coronavirus disease model research application field.
Inventors
- ZENG WENTAO
- LI JIANMIN
- LAI YANA
- SHI AIMIN
- ZHANG AIHUA
Assignees
- 南京医科大学
Dates
- Publication Date
- 20260512
- Application Date
- 20260109
Claims (10)
- 1. A construction method of an Ace2 gene modified golden hamster model is characterized by comprising the steps of injecting a Cas9 functional element and sgRNA targeting an Ace2 gene exon 2 into an embryo transfer receptor body under a red light source through a two-cell embryo, and further obtaining the Ace2 gene modified golden hamster model.
- 2. The construction method according to claim 1, wherein the target site of the gene to be knocked out of the golden hamster is determined, and a sgRNA targeting the golden hamster Ace2 gene is designed, the nucleotide sequence of the sgRNA being shown as SEQ ID NO. 1.
- 3. The construction method according to claim 1 or 2, wherein the preparation of the sgRNA comprises annealing primers gAce to Sg1F and gAce to Sg1R to form a double-stranded DNA fragment, inserting the double-stranded DNA fragment into a BsaI-linearized PUC57-CRISP9 vector, transforming and screening to obtain a sgRNA expression plasmid, and synthesizing and purifying the sgRNA expression plasmid in vitro by using the correct sgRNA expression plasmid as a template, wherein the nucleotide sequence of gAce to Sg1F is shown as SEQ ID NO:2, and the nucleotide sequence of gAce to Sg1R is shown as SEQ ID NO: 3.
- 4. The construction method of claim 3, wherein the PUC57-CRISP9 vector is a PUC57-CRISP9-sgRNA-GFP plasmid, and the construction method of the PUC57-CRISP9-sgRNA-GFP plasmid comprises the steps of carrying out restriction enzyme digestion on the PUC57 plasmid by using Not I and Xho I restriction enzymes to obtain 2608 bp fragments serving as a PUC57-CRISP9 vector skeleton, and inserting a U6-T7-GFP-tracrRNA sequence with a nucleotide sequence shown as SEQ ID NO:9 into the PUC57-CRISP9 vector skeleton to construct the PUC57-CRISP9-sgRNA-GFP plasmid.
- 5. The construction method according to any one of claims 1-4, characterized in that the method comprises in particular the following steps: (1) Under a red light source, co-injecting active sgRNA and a Cas9 functional element into cytoplasm or nucleus of a golden hamster two-cell embryo, transplanting the injected embryo into a recipient female mouse for inoculation to obtain an F0 generation hamster, and carrying out PCR identification and sequencing; (2) Hybridizing the F0 generation hamster with a wild hamster to obtain an F1 generation hamster, and performing PCR identification and sequencing; (3) And (3) hybridizing the F1 generation heterozygote hamsters to obtain F2 generation hamsters, and carrying out PCR identification and sequencing to obtain the homozygote with stable inheritance, namely the Ace2 gene modified golden hamster animal model.
- 6. The method of claim 1 or 5, wherein the Cas9 functional element is Cas9 mRNA or Cas9 protein.
- 7. The construction method according to claim 5, wherein the PCR identified specific primer pair comprises Ace2-TOF, ace2-TOR, ace2-TIF and Ace2-TIR, the nucleotide sequence of the Ace2-TOF is shown in SEQ ID NO. 4, the nucleotide sequence of the Ace2-TOR is shown in SEQ ID NO. 5, the nucleotide sequence of the Ace2-TIF is shown in SEQ ID NO. 6, and the nucleotide sequence of the Ace2-TIR is shown in SEQ ID NO. 7.
- 8. Use of an Ace2 genetically modified hamster model constructed by the method of any one of claims 1 to 7 in any one of: (1) Researching infection mechanism of SARS-CoV-2 virus; (2) Researching related functions and action mechanisms of Ace2 genes; (3) Screening SARS-CoV-2 virus infection therapeutic medicine; (4) And screening kidney injury therapeutic drugs as kidney injury models.
- 9. Use of an Ace2 gene modified hamster model constructed by the method of any one of claims 1 to 7 for the development of a vaccine for the prevention of SARS-CoV-2 virus infection.
- 10. Use of an Ace2 gene modified hamster model constructed by the method of any one of claims 1 to 7 in the assessment of a novel strain of SARS-CoV-2.
Description
Construction method and application of Ace2 gene modified golden hamster model Technical Field The invention belongs to the technical field of construction of genetic engineering animal models, and particularly relates to a construction method and application of an Ace2 gene modified golden hamster model. Background SARS-CoV-2 has serious infectivity and morbidity, and has become the priority item for research in the related medicine field, while an ideal animal model plays an important role in the research of new coronary pathogenesis, vaccine research test, therapeutic drug evaluation and other aspects. SARS-CoV-2 is similar to SARS-CoV in that SARS-CoV-2 enters host cells by attaching to the cellular angiotensin converting enzyme 2 (ACE 2), whereas the mouse cognate receptor ACE2 (mACE 2) cannot mediate viral invasion due to the amino acid key site differences, and a humanized gene transfer is required to infect, resulting in an infection phenotype that is not completely consistent with human clinic. Golden hamster ACE2 is highly homologous to human SARS-CoV-2 infection target and can be directly infected by SARS-CoV-2. The combination of the golden hamster has the advantages of easy operation, easy reproduction, low cost and the like, and is considered as one of the best small animal models for researching SARS-CoV-2 and variants thereof. Therefore, establishing an Ace2 gene modified golden hamster model has a deeper significance in the research application of SARS-CoV-2. Disclosure of Invention Aiming at the technical problems of the background technology, the invention aims to provide a method for establishing an Ace2 gene modified golden hamster model and application thereof. According to the invention, through CRISPR-Cas9 technology, under a microscope with a red color filter of a red light chamber, the Cas9 protein and sgRNAs of the targeted Ace2 exon 2 are injected through a two-cell embryo to generate Ace 2-deficient golden hamsters so as to avoid early embryo development arrest. Embryo offspring were constructed by true pregnancy albino receptor embryo transfer and used to study SARS-CoV-2 infection models. The invention aims at realizing the following technical method: In a first aspect, the invention claims a method for constructing an Ace2 gene modified golden hamster model, comprising injecting Cas9 functional element and sgRNA targeting Ace2 gene exon 2 into an embryo transfer recipient body under a red light source, thereby obtaining the Ace2 gene modified golden hamster model. Furthermore, the construction method designs the sgRNA of the target golden hamster Ace2 gene by determining the target site of the gene to be knocked out of the golden hamster, and the nucleotide sequence of the sgRNA is shown as SEQ ID NO. 1. gAce2-Sg1(sgRNA):TACCATCAAGCGTCAACTGCAGG(SEQ ID NO:1)。 Further, the process for preparing the sgRNA comprises the steps of annealing primers gAce2-Sg1F and gAce2-Sg1R to form a double-stranded DNA fragment, inserting the double-stranded DNA fragment into a BsaI-linearized PUC57-CRISP9 vector, transforming and screening to obtain an sgRNA expression plasmid, synthesizing and purifying the sgRNA expression plasmid serving as a template through in vitro transcription by taking the correct sgRNA expression plasmid as a template, wherein the nucleotide sequence of gAce2-Sg1F is shown as SEQ ID NO. 2, and the nucleotide sequence of gAce2-Sg1R is shown as SEQ ID NO. 3. gAce2-Sg1F:TAGGTACCATCAAGCGTCAACTGC(SEQ ID NO:2); gAce2-Sg1R:AAACGCAGTTGACGCTTGATGGTA(SEQ ID NO:3)。 Further, the PUC57-CRISP9 vector is a PUC57-CRISP9-sgRNA-GFP plasmid, and the construction method of the PUC57-CRISP9-sgRNA-GFP plasmid comprises the steps of carrying out restriction enzyme digestion on the PUC57 plasmid by using Not I and Xho I to obtain 2608 bp fragments serving as a PUC57-CRISP9 vector skeleton, and inserting U6-T7-GFP-tracrRNA sequences with nucleotide sequences shown as SEQ ID NO 9 into the PUC57-CRISP9 vector skeleton to construct the PUC57-CRISP9-sgRNA-GFP plasmid. Further, the construction method specifically comprises the following steps: (1) Under a red light source, co-injecting active sgRNA and a Cas9 functional element into cytoplasm or nucleus of a golden hamster two-cell embryo, transplanting the injected embryo into a recipient female mouse for inoculation to obtain an F0 generation hamster, and carrying out PCR identification and sequencing; (2) Hybridizing the F0 generation hamster with a wild hamster to obtain an F1 generation hamster, and performing PCR identification and sequencing; (3) And (3) hybridizing the F1 generation heterozygote hamsters to obtain F2 generation hamsters, and carrying out PCR identification and sequencing to obtain the homozygote with stable inheritance, namely the Ace2 gene modified golden hamster animal model. Further, the aforementioned Cas9 functional element is Cas9 mRNA or Cas9 protein. Further, the specific primer pair identified by the PCR comprises