Search

CN-122012677-A - Real-time fluorescence quantitative PCR detection method for total RNA residual quantity of escherichia coli

CN122012677ACN 122012677 ACN122012677 ACN 122012677ACN-122012677-A

Abstract

The invention provides a real-time fluorescence quantitative PCR detection method for total RNA residual quantity of escherichia coli, which comprises the following steps: 3-5 mu L TAQMAN RT-PCR Buffer (5×), 1-3 mu L TaqMan Enzyme Mix (10×), 0.3-0.5 mu L ROX REFERENCE DYE (50×), 1-1.5 mu L8-12 mu M forward specific primer, 1-1.5 mu L8-12 mu M reverse specific primer, 0.5-0.8 mu L8-12 mu M specific probe, 4-6 mu L standard or sample to be tested, RT-PCR grade water make up to 20 mu L, reaction procedure: 4-6 min at 52-54 ℃; 94-96 ℃ for 18-22 s; 94-96 ℃ for 4-6 s, 56-58 ℃ for 38-42 s, 44-46 cycles, the detection limit of the invention is as low as 2pg/mL.

Inventors

  • LI XIN
  • JIANG JIAHUI
  • PU XIJUN
  • Tang Xinya
  • YE YILIN
  • ZHOU XIN
  • HU SHANGJIE
  • REN KEYUN
  • WANG XIAO

Assignees

  • 楷拓生物科技(苏州)有限公司
  • 武汉楷拓生物科技有限公司
  • 上海楷拓生物科技有限公司

Dates

Publication Date
20260512
Application Date
20260113

Claims (10)

  1. 1. A real-time fluorescence quantitative PCR detection method for total RNA residual quantity of escherichia coli is characterized in that a reaction system of the real-time fluorescence quantitative PCR detection method comprises ：3~5μL Taqman RT-PCR Buffer（5×）,1~3μL TaqMan Enzyme Mix（10×）,0.3~0.5μL ROX Reference Dye（50×）,1~1.5μL 8~12μM forward specific primers, 1-1.5 mu L8-12 mu M reverse specific primers, 0.5-0.8 mu L8-12 mu M specific probes, 4-6 mu L standard substances or samples to be detected, RT-PCR grade water is complemented to 20 mu L, The reaction program of the real-time fluorescence quantitative PCR detection method is as follows: 52-54 ℃ for 4-6 min, 94-96 ℃ for 18-22 s, 94-96 ℃; C4-6 s, 56-58 ℃ 38-42 s, 44-46 cycles.
  2. 2. The method for real-time fluorescent quantitative PCR detection of total RNA residual amount of E.coli according to claim 1, wherein the reaction system of the method for real-time fluorescent quantitative PCR detection comprises 4. Mu. L TAQMAN RT-PCR Buffer (5X), 2. Mu. L TaqMan Enzyme Mix (10X), 0.4. Mu.L ROX REFERENCE DYE (50X), 1.2. Mu.L 10. Mu.M forward specific primer, 1.2. Mu.L 10. Mu.M reverse specific primer, 0.6. Mu.L 10. Mu.M specific probe, 5. Mu.L standard or sample to be detected, RT-PCR grade water is made up to 20. Mu.L, The reaction program of the real-time fluorescence quantitative PCR detection method is 53 ℃ for 5min, 95 ℃ for 20s, 95 ℃ for 5s,57 ℃ for 40s and 45 cycles.
  3. 3. The method for real-time fluorescent quantitative PCR detection of total RNA residual amount of Escherichia coli according to claim 1, wherein the nucleotide sequences of the amplified fragments of the forward and reverse specific primers are CGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTATCCTTTGTTGCCAGCGG, The two ends of the specific probe are marked with fluorescent groups and/or quenched fluorescent groups.
  4. 4. The method for real-time fluorescent quantitative PCR detection of total RNA residual amount of Escherichia coli according to claim 1, wherein the nucleotide sequence of the forward specific primer is 5'-CGTGTTGTGAAATGTTGGGTTAA-3', The nucleotide sequence of the reverse specificity primer is 5'-CCGCTGGCAACAAAGGATA-3', The nucleotide sequence of the specific probe is 5'-TCCCGCAACGAGCGCAACC-3'.
  5. 5. The method for real-time fluorescent quantitative PCR detection of total RNA residual amount of E.coli according to claim 4, wherein the specific probe has a fluorescent group FAM marked at the 5 'end and a quenching fluorescent group TAMRA marked at the 3' end.
  6. 6. The method for real-time fluorescent quantitative PCR detection of total RNA residual amount of E.coli according to claim 1, wherein the standard comprises E.coli total RNA reference solution or self-made E.coli total RNA solution with concentration of 2pg/mL, 20pg/mL, 200pg/mL, 2000pg/mL and 20000 pg/mL.
  7. 7. The method for real-time fluorescent quantitative PCR detection of total RNA residual amount of E.coli according to claim 1, wherein the sample to be detected is a plasmid solution subjected to pretreatment including DNA elimination reaction and RT-PCR grade water dilution.
  8. 8. The method for real-time fluorescence quantitative PCR detection of total RNA residual amount of Escherichia coli according to claim 7, wherein the reaction system of the DNA elimination reaction comprises 18-22. Mu.L of plasmid sample, 8-12. Mu.L of 10 XDNase I Buffer, 38-42. Mu.L of DNase I, and no RNase water to 100. Mu.L, wherein DNase I concentration is 4-6U/. Mu.L, the reaction system of the DNA elimination reaction is incubated at 36-38 ℃ for 50-70 min, heated at 74-76 ℃ for 8-12 min, cooled on ice, centrifugally mixed, and diluted to plasmid concentration of 500-2000 ng/mL by RT-PCR grade water.
  9. 9. The method for real-time fluorescent quantitative PCR detection of total RNA residual amount of E.coli according to claim 8, wherein the reaction system of the DNA elimination reaction comprises 20. Mu.L of plasmid sample, 10. Mu.L of 10 XDNase I Buffer, 40. Mu.L of DNase I, no RNase water to 100. Mu.L, wherein DNase I concentration is 5U/. Mu.L, the reaction system of the DNA elimination reaction is incubated at 37 ℃ for 60min, heated at 75 ℃ for 10min, cooled on ice, centrifugally mixed, and diluted to plasmid concentration of 1000ng/mL by RT-PCR grade water.
  10. 10. A real-time fluorescent quantitative PCR detection kit for total RNA residual quantity of escherichia coli is characterized by comprising Taqman RT-PCR Buffer (5×), taqMan Enzyme Mix × (10×), ROX REFERENCE DYE (50×), 8-12 mu M forward specific primer, 8-12 mu M reverse specific primer, 8-12 mu M specific probe, standard substance and RT-PCR grade water in a reaction system of the real-time fluorescent quantitative PCR detection method according to claims 1-9.

Description

Real-time fluorescence quantitative PCR detection method for total RNA residual quantity of escherichia coli Technical Field The invention relates to the field of detection of total RNA of escherichia coli, in particular to a real-time fluorescent quantitative PCR detection method of total RNA residual quantity of escherichia coli. Background In recent years, with the rapid development of the gene and cell therapy fields and the wide application of mRNA vaccine technology, plasmids as core raw materials for gene delivery vectors, mRNA vaccine templates and virus vector production have shown broad prospects in various fields such as gene therapy, cell therapy, vaccine development, infectious disease prevention and control, agriculture and environmental protection. The us FDA clearly states that less than 1% residual bacterial RNA is required in plasmid material. The residual RNA from e.coli (e.coli) may activate the cellular interferon pathway, eliciting unwanted immune responses or inflammation, and pose a potential threat to the safety of gene therapy or cell therapy products. Therefore, E.coli RNA residue detection has become an indispensable key indicator in plasmid production process optimization and finished product release. Currently, common methods for detecting E.coli host RNA residues in plasmids include agarose gel electrophoresis, high Performance Liquid Chromatography (HPLC) and fluorescent quantitative PCR (qPCR). Agarose gel electrophoresis is low in sensitivity, difficult to accurately quantify, and susceptible to DNA or protein contamination, while HPLC is generally inferior to qPCR in terms of sequence specificity and sensitivity. The patent with the application number of CN201210202181.7 discloses a method for quantitatively detecting the RNA of escherichia coli, which adopts a qPCR dye method, has lower specificity than a probe method and is a two-step RT-qPCR method, the operation is more complicated, the detection limit of the detection method reported by the CN202310733025.1 patent is 10pg/mL, the linear range and the detection sensitivity still have a lifting space, and the CN202410125081.1 patent realizes direct detection through the optimization of a pretreatment system, but the experimental process is difficult to reproduce in other experimental environments. Therefore, it is of great importance to develop a one-step RT-qPCR detection method which has a wider linear range and a lower detection limit and can effectively monitor the total RNA residual quantity of the escherichia coli in a plasmid product. Disclosure of Invention The invention aims to provide a real-time fluorescence quantitative PCR detection method for total RNA residual quantity of escherichia coli, which has wider linear range and lower detection limit. In order to achieve the above purpose, the invention adopts the following technical scheme: The invention provides a real-time fluorescence quantitative PCR detection method for total RNA residual quantity of escherichia coli, wherein a reaction system of the real-time fluorescence quantitative PCR detection method comprises ：3~5μL Taqman RT-PCR Buffer（5×）,1~3μL TaqMan Enzyme Mix（10×）,0.3~0.5μL ROX Reference Dye（50×）,1~1.5μL 8~12μM forward specific primers, 1-1.5 mu L of 8-12 mu M reverse specific primers, 0.5-0.8 mu L of 8-12 mu M specific probes, 4-6 mu L of standard substances or samples to be detected, and RT-PCR grade water is filled to 20 mu L, and the reaction program of the real-time fluorescence quantitative PCR detection method is 52-54 ℃ for 4-6 min, 94-96 ℃ for 18-22 s, 94-96 ℃ for 4-6 s, 56-58 ℃ for 38-42 s and 44-46 cycles. According to some specific and preferred embodiments of the present invention, the reaction system of the real-time fluorescent quantitative PCR detection method comprises 4 mu L TAQMAN RT-PCR Buffer (5×), 2 mu L TaqMan Enzyme Mix,0.4 mu L ROX REFERENCE DYE (50×), 1.2 mu L10 mu M forward specific primer, 1.2 mu L10 mu M reverse specific primer, 0.6 mu L10 mu M specific probe, 5 mu L standard or sample to be detected, RT-PCR grade water up to 20 mu L, and the reaction procedure of the real-time fluorescent quantitative PCR detection method is 53 ℃ 5min, 95 ℃ 20s, 95 ℃ 5s,57 ℃ 40s,45 cycles. In an embodiment of the invention, the forward specific primer, reverse specific primer and specific probe are designed based on the E.coli 16s rRNA sequence. According to some specific and preferred embodiments of the invention, the forward specific primer, the reverse specific primer, and the amplified fragment have a nucleotide sequence of CGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTATCCTTTGTTGCCAGCGG. According to some specific and preferred embodiments of the invention, the nucleotide sequence of the forward specific primer is 5'-CGTGTTGTGAAATGTTGGGTTAA-3', the nucleotide sequence of the reverse specific primer is 5'-CCGCTGGCAACAAAGGATA-3', and the nucleotide sequence of the specific probe is 5'-TCCCGCAACGAGCGCAACC-3'. In an embodiment of