CN-122012700-A - Marker combination for assisting in diagnosis of depression and related disorders and application thereof
Abstract
The application provides a marker combination for assisting in diagnosing depression and related diseases and specific application thereof, wherein the marker combination comprises four circulating small RNAs, and the sequences of the four circulating small RNAs are respectively shown as SEQ ID No.1-SEQ ID No. 4. The technical scheme provided by the application has the remarkable beneficial effects that a biomarker combination consisting of four circulating small RNAs is screened and verified for the first time, the diagnosis efficiency, the objective quantification capability, the noninvasive detection advantage and the extremely high clinical operation feasibility are achieved, a revolutionary tool is provided for the accurate diagnosis and layering management of the major depression, and the method has great clinical value and social significance.
Inventors
- ZHANG CHENYU
- WANG YANBO
- XU RUIZHI
- ZHOU SHENGKAI
- GUAN DANPING
Assignees
- 南京大学
Dates
- Publication Date
- 20260512
- Application Date
- 20260402
Claims (10)
- 1. A marker combination for assisting in diagnosing depression and related diseases is characterized by comprising one or more of rsRNA- #146, rsRNA- #69, miR-20a-5p and miR-93-5p, wherein the sequences of the marker combination are shown as SEQ ID No. 1-SEQ ID No. 4.
- 2. The application of the primer combination in preparing a reagent for assisting in diagnosing depression and related diseases is characterized in that the marker combination comprises one or more of rsRNA- #146, rsRNA- #69, miR-20a-5p and miR-93-5p, and the sequences of the marker combination are respectively shown as SEQ ID No. 1-SEQ ID No. 4.
- 3. The use of claim 2, wherein the primer combination comprises a primer pair for detecting at least one sRNA marker of rsRNA- #146, rsRNA- #69, miR-20a-5p, and miR-93-5p, wherein: The primer pair for detecting rsRNA- #146, rsRNA- #69, miR-20a-5p and miR-93-5p consists of an upstream primer and a downstream primer, wherein the nucleotide sequences of the upstream primer are respectively shown as SEQ ID No.5, SEQ ID No.7, SEQ ID No.9 and SEQ ID No.11, and the nucleotide sequences of the downstream primer are shown as SEQ ID No.6, SEQ ID No.8, SEQ ID No.10 and SEQ ID No. 12.
- 4. Use of a marker combination in the manufacture of a kit for aiding in the diagnosis of depression and related disorders, wherein the kit is a real-time fluorescent quantitative qRT-PCR kit, and wherein the marker combination is the marker combination of claim 1.
- 5. The use of claim 4, wherein the use of the kit comprises one or more of the following: 1) For aiding in the diagnosis of depression; 2) Is used for assisting in the differential diagnosis of depression and bi-directional affective disorder; 3) Is used for assisting in diagnosis of the severity grade of depression.
- 6. The use of claim 5, wherein the kit comprises a primer set for aiding in the diagnosis of depression and related disorders, the primer set comprising a primer pair for detecting at least one sRNA marker of rsRNA- #146, rsRNA- #69, miR-20a-5p, and miR-93-5p, wherein: The primer pair for detecting rsRNA- #146, rsRNA- #69, miR-20a-5p and miR-93-5p consists of an upstream primer and a downstream primer, wherein the nucleotide sequences of the upstream primer are respectively shown as SEQ ID No.5, SEQ ID No.7, SEQ ID No.9 and SEQ ID No.11, and the nucleotide sequences of the downstream primer are shown as SEQ ID No.6, SEQ ID No.8, SEQ ID No.10 and SEQ ID No. 12.
- 7. The use of claim 6, wherein the kit further comprises a total sRNA extraction kit and an RNA reverse transcription kit.
- 8. The use according to claim 7, wherein the total sRNA extraction reagent set comprises a protein denaturation lysate, chloroform, ethanol and a rinse solution, and/or the RNA reverse transcription reagent set comprises a reverse transcription primer, a reverse transcription reaction buffer and a reverse transcriptase mix.
- 9. The use according to claim 8, wherein the kit further comprises an internal reference gene U6 amplification primer, and the sequence of the internal reference gene U6 amplification primer is: The forward primer of the reference gene U6 is GCTTCGGCAGCACATATACTAAA; The reverse primer of the reference gene U6 is TTTGCGTGTCATCCTTGCG.
- 10. The use according to claim 9, wherein the reaction conditions of the real-time fluorescent quantitative qRT-PCR one-step method are 16℃for 5min, 50℃for 15min, 95℃for 10min, 95℃for 15s,60℃for 40s,50 cycles, and fluorescent signals are detected and collected at 60 ℃.
Description
Marker combination for assisting in diagnosis of depression and related disorders and application thereof Technical Field The application relates to the technical field of biology, in particular to a marker combination for assisting in diagnosing depression and related symptoms thereof and application thereof. Background Depression (MDD) is a high prevalence, high disabling, major mental disorder, and is a primary premise for its accurate, timely diagnosis, effective intervention, and improved prognosis. However, current clinical diagnostic practices of MDD face serious reliability challenges. Diagnosis is mainly carried out according to symptomatic standards in mental disorder diagnosis and statistics handbook (DSM) or International Classification of Diseases (ICD), and is aided with tools such as Hamilton depression rating scale (HAMD) and the like for severity assessment. This set of architecture relies entirely on the patient's self-reporting of subjective psychological experiences and somatic symptoms, as well as the observation and judgment of the clinician based on interviews. This "subjective versus subjective" model has inherent drawbacks in that patients may fail to accurately or completely describe symptoms due to cognitive bias, pubic feeling, or difficulty in expression, in that different textual backgrounds differ in the expression of emotional distress, and in that clinician experience and expertise also directly affect the consistency of diagnosis. The direct consequences are insufficient diagnostic reliability, manifested by misdiagnosis, missed diagnosis, delayed diagnosis and differences in diagnostic conclusions between different evaluators. Although HAMD scores have been shown to be associated with the extent of functional impairment, their nature as a subjective scale limits their value in screening, primary medical applications, and objective monitoring of long-term efficacy. Thus, the field of psychiatry has long been striving to find objective, quantifiable, easily detectable biological diagnostic indicators to make up for the shortfall of pure clinical diagnosis, driving the diagnosis to span from "descriptive" to "biological". In recent years, the development of liquid biopsy technology has brought new hopes for objective diagnosis of mental diseases. Circulating small RNAs (sRNAs), including microRNAs (miRNAs), tRNA derived fragments (tsRNAs), and the like, are considered to be very promising sources of non-invasive biomarkers because they exist stably in body fluids such as blood, cerebrospinal fluid, and the like, and their expression profiles can sensitively reflect pathophysiological states of local tissues, including the brain. In particular, mirnas have been studied extensively to demonstrate involvement in biological processes closely related to the onset of depression, such as stress response, neuroplasticity, neuroinflammation, etc. The high-throughput small RNA sequencing technology enables unbiased comprehensive analysis of circulating sRNA groups, and provides a powerful tool for finding novel diagnostic markers. However, the prior studies in the field have obvious limitations that most of the studies have small sample size, low statistical efficiency and poor robustness of the found markers, the studies are concentrated on a single category of miRNA, important information possibly contained in other types of sRNAs (such as tsRNA and rsRNA) is ignored, and more importantly, most of the preliminarily found markers lack strict verification in independent and large-scale clinical queues, so that the transformation of the clinical application of the markers is seriously blocked. In summary, developing an objective diagnosis model based on a large-scale multi-center queue, integrating multi-category circular sRNA information and carrying out strict prospective verification has great significance for establishing a reliable, standardized and generalized MDD diagnosis method. The research aims at constructing and verifying an objective biomarker panel for MDD diagnosis by systematically exploring a circulating sRNA group so as to finally provide a laboratory detection means capable of assisting and even partially replacing the current subjective evaluation for clinic, thereby improving the accuracy, consistency and early discovery capability of depression diagnosis. Disclosure of Invention In view of the above-mentioned technical limitations, the present application proposes a marker combination for aiding in the diagnosis of depression and related disorders and uses thereof, which overcomes the deficiencies and drawbacks mentioned in the background art. In order to achieve the above purpose, the present application adopts the following technical scheme: The application provides a marker combination for assisting in diagnosing depression and related diseases, which comprises one or more of rsRNA- #146, rsRNA- #69, miR-20a-5p and miR-93-5p, and the sequences of the marker com