Search

CN-122012715-A - Lock probe based on Fpg enzyme and CRISPR/Cas12a combination and used for detecting G > A mutation in gene mutation, detection kit, detection method and application thereof

CN122012715ACN 122012715 ACN122012715 ACN 122012715ACN-122012715-A

Abstract

The invention provides a lock-type probe for detecting G > A mutation in gene mutation, which comprises a recognition sequence complementary to a target p 53R 175H and a CRISPR/Cas12a recognition sequence, and is modified with 8-oxo guanine. The invention also provides a G > A mutation universal detection kit based on the combination of Fpg enzyme and CRISPR/Cas12a, which comprises the lock-type probe, a fluorescent report probe, a primer, crRNA, T4 DNA ligase, fpg enzyme, phi29 DNA polymerase and Cas12a protein. The invention also provides a G > A mutation detection method and application thereof. The invention successfully constructs a G > A mutation universal detection method based on the combination of Fpg enzyme and CRISPR/Cas12a, and a cascade signal amplification system of the CRISPR/Cas12a and the mutation point-binding rolling circle amplification is identified by an 8-oxoG modified lock probe, so that the defects of universality caused by restriction enzyme dependence and core bottleneck of strict dependence of Cas protein on target PAM sites in the existing mutation detection technology are overcome, and the broad-spectrum and accurate detection of all G > A point mutations is realized.

Inventors

  • ZHOU SHIYING
  • WU JIANMING
  • HUANG CHUNLAN
  • XIANG TINGTING
  • Cha Zengqin

Assignees

  • 西南医科大学

Dates

Publication Date
20260512
Application Date
20260226

Claims (10)

  1. 1. A lock-type probe for detecting G > A mutation in gene mutation is characterized by comprising a recognition sequence complementary to a target p 53R 175H and a sequence recognized by CRISPR/Cas12a, and being modified with 8-oxo-guanine.
  2. 2. The padlock probe according to claim 1, wherein the base sequence of the lock-type probe is p-GGGGGCAG/i8oxodG/GCCTCACAACCTTCTCTGCTCGACGGAAATAAGAGATAATAAGAGATCGCTCATGGT.
  3. 3. A G > A mutation universal detection kit based on the combination of Fpg enzyme and CRISPR/Cas12a is characterized by comprising the locking probe as set forth in claim 1 or 2, a fluorescent reporter probe, a primer and crRNA, wherein both ends of the fluorescent reporter probe are modified with a fluorescent group and a quenching group, and the fluorescent reporter probe can be cut by a trans-cleavage activity activated by Cas12a, and the sequence is HEX-TATTATT-BHQ1; the primer can be combined with a circularized locking probe, and long repeated single-stranded DNA is obtained through amplification, and the base sequence is TCCGTCGAGCAGAGAA; the crRNA is combined with Cas12a protein to form ribonucleoprotein complex, and the base sequence is UAAUUUCUACUAAGUGUAGAUAAUAAGAGAUAAUAAGAGAU.
  4. 4. The G > A mutation universal detection kit based on the combination of Fpg enzyme and CRISPR/Cas12a according to claim 3, wherein the kit comprises T4 DNA ligase, fpg enzyme, phi29 DNA polymerase and Cas12a protein.
  5. 5. A G > A mutation detection method is characterized in that the method adopts the universal G > A mutation detection kit based on the combination of Fpg enzyme and CRISPR/Cas12a as claimed in claim 3 or 4 for detection, and comprises the following steps: a. Extracting genome DNA in a sample to be detected as a target gene to be detected; b. B, mixing the target gene in the step a with the lock probe, T4 DNA ligase and Fpg enzyme, carrying out denaturation annealing, and then incubating to obtain a cyclization probe, mixing crRNA and Cas12a protein, and incubating to obtain a ribonucleoprotein complex; c. C, rolling circle amplification reaction and Cas12a shearing reaction, namely mixing and incubating the circularized probe prepared in the step b with a primer, dNTP, phi29 DNA polymerase, a fluorescent reporter probe and a ribonucleoprotein complex; d. Fluorescence detection, namely obtaining the detection result of the target gene by detecting the fluorescent signal of the ssDNA reporter molecule marked by the fluorophore-quencher.
  6. 6. The method for detecting G > A mutation according to claim 5, wherein the sample to be detected in the step a comprises blood, body fluid, tissue or cells isolated from the body, and the incubation temperatures in the step b and the step C are 37 ℃.
  7. 7. The method for detecting a G > a mutation according to claim 5 or 6, wherein: b, mixing a target gene, a lock probe and ddH 2 O, carrying out denaturation incubation at 95 ℃ for 5 minutes, and slowly annealing at room temperature, adding T4 DNA ligase with the concentration of 1.1X10 4 ~4×10 4 U/mL, a T4 DNA ligase Buffer solution, fpg enzyme with the concentration of 0.3X10 3 ~1.3×10 3 U/mL and corresponding Buffer 1, and incubating for 20-60 minutes to obtain a cyclization probe, and simultaneously preparing Cas12a ribonucleoprotein complex, wherein the ddH 2 O, the corresponding Buffer 1 and crRNA/Cas12a protein (molar ratio of 1:1) are mixed, and incubating for 30 minutes to obtain the ribonucleoprotein complex; And c, rolling circle amplification reaction and Cas12a shearing reaction, namely mixing and incubating a circularized probe with a primer of 100 nM, dNTPs of 25 mM, phi29 DNA polymerase reaction buffer solution, phi29 DNA polymerase with the concentration of 0.2X10 3 ~1×10 3 U/mL, a fluorescent reporter probe of 10 nM and ribonucleoprotein complex with the concentration of 0.1-1 nM for 60-160 minutes.
  8. 8. The method for detecting a G > A mutation according to claim 7, wherein: b, the concentration of the T4 DNA ligase in the step (b) is 2 multiplied by 10 4 U/mL, the concentration of the Fpg enzyme in the step (b) is 4.4 multiplied by 10 2 U/mL, and the incubation time is 40 minutes; Step c the phi29 DNA polymerase concentration was 4X 10 2 U/mL, ribonucleoprotein complex was 0.4 nM, and incubation time was 120 minutes.
  9. 9. Use of a lock-in probe for G > a mutation detection in gene mutation according to claim 1 or 2, a G > a mutation universal detection kit based on the use of Fpg enzyme in combination with CRISPR/Cas12a according to claim 3 or 4 for the preparation of a kit for diagnosis of leukemia or tumor.
  10. 10. The method according to claim 9, wherein the leukemia is acute myeloid leukemia and the tumor comprises lung cancer, breast cancer, colorectal cancer, glioblastoma.

Description

Lock probe based on Fpg enzyme and CRISPR/Cas12a combination and used for detecting G > A mutation in gene mutation, detection kit, detection method and application thereof Technical Field The invention relates to the technical field of gene detection, in particular to a G > A mutation universal detection method based on the combination of Fpg enzyme and CRISPR/Cas12 a. Background Gene mutation is a common genetic material change phenomenon in the biological world, is one of core driving forces of biological evolution, provides abundant genetic diversity for biotics groups through substitution, insertion, deletion and other forms, promotes the species to adapt to environmental changes in long natural selection, and realizes evolution iteration. In the fields of molecular biology and medicine, mutation is a key point for analyzing vital activity mechanisms and revealing occurrence and development rules of diseases. Under normal conditions, stable expression of genes maintains accurate regulation of physiological processes such as cell proliferation, differentiation, apoptosis and the like, and abnormal mutation of specific genes often breaks the balance, causes change of protein structure and function, further causes disorder of cell metabolism and abnormal signal paths, finally induces occurrence and development of various diseases, especially serious diseases such as malignant tumor, hereditary diseases and the like, and is closely related to the gene mutation. In addition, mutation provides an important target for diagnosis, treatment and drug research and development of diseases, and by analyzing the association of mutation types and disease phenotypes, targeted molecular diagnosis technology, targeted therapeutic drugs and gene editing therapies can be developed, so that the method has irreplaceable significance in improving the prevention and control level of diseases. The p53 gene is used as a 'keeper of genome', is a key cancer suppressor gene, and the coded protein can maintain the stability of genome and inhibit tumorigenesis by regulating cell cycle check points, mediating DNA damage repair and abnormal apoptosis. The gene is one of the genes with highest mutation frequency in human tumors, and has been found to be of mutation type of thousands, wherein missense mutation accounts for 50% -60% and is a main mutation form. Among the many p53 missense mutations, the p 53R 175H mutation (substitution of arginine at position 175 with histidine) has outstanding uniqueness and significance, and is the most deeply studied and clinically relevant hotspot mutation type. The core value of the mutant is that the mutant has high mutation frequency and can be widely used in malignant tumors such as lung cancer, breast cancer, colorectal cancer and the like, and glioblastoma and the like; the method has the advantages that the functional damage is remarkable, the site is positioned in the p53 protein core DNA binding domain, the mutation directly loses DNA binding capacity, so that the cancer inhibition function is lost, meanwhile, the wild type p53 function is inhibited through the dominant negative effect, the novel cancer promotion function can be obtained, the malignant progress of tumors is accelerated, the clinical significance is definite, the malignant degree of patients carrying the mutation is higher, the prognosis is worse, the drug resistance to chemotherapeutic drugs such as cisplatin is easy to generate, and the method is a core target for tumor diagnosis, prognosis evaluation and targeted therapy, and the research value is remarkable, so that the method is used as an ideal model for analyzing the p53 protein structural function relationship and the mutant cancer promotion mechanism, and provides important theoretical support for the development of other p53 mutation related therapeutic strategies. As Sanger sequencing of mutation detection gold standard, the method has the advantages of single base resolution and direct visualization of mutation sites, but has remarkable limitations in practical application, namely the method is operated by a professional molecular biology technician, a large-scale gene sequencer is equipped, and the complete period from sample preparation to result interpretation usually takes 24-48 hours, so that the clinical rapid detection requirement is difficult to meet. To overcome the bottleneck of the conventional sequencing technology, researchers have developed a series of detection alternative technologies such as allele-specific PCR (ARMS-PCR), digital PCR (dPCR), high resolution melting curve analysis (HRM), and the like. However, there are still many problems in the prior art system, such as the design bottleneck of the primers for ARMS-PCR, sensitivity of the temperature of the HRM, etc. At present, the isothermal amplification technology has the advantages of simple design and high specificity, remarkably improves the detection sensitivity and specificity after be