Search

CN-122012724-A - Primer pair, method and application for identifying breeding and wild population of Thangustifolia based on SNP (Single nucleotide polymorphism) markers

CN122012724ACN 122012724 ACN122012724 ACN 122012724ACN-122012724-A

Abstract

The invention belongs to the technical fields of population genetics and molecular biology, and particularly relates to a primer pair, a method and application for identifying a breeding and wild population of Thangfish based on SNP (single nucleotide polymorphism) markers. The SNP marker is positioned at 996 th position of a sequence shown as SEQ ID NO. 1, the base mutation type is A/G, and 2 pairs of primers for identifying the breeding and wild population of the Thangfish are designed, wherein the primers comprise a common forward primer F and a common reverse primer R, the sequence of the common forward primer F is shown as SEQ ID NO. 3, and the sequence of the reverse primer R is shown as SEQ ID NO. 2 and 4. The invention also discloses a method and application for rapidly identifying the breeding and wild population of the Tang fish by using the primer pair or the kit. The invention fills the technical blank in the aspects of the cultivation of the Tang fish and the rapid identification of wild population, has important value for the management and protection of the genetic resources of the Tang fish, and can provide technical reference for the identification of other fish germplasm sources.

Inventors

  • LI CHAO
  • LI JUNWU
  • LIANG FANG
  • XU JIAQI
  • CHEN GUANRU
  • REN MEILING

Assignees

  • 华南师范大学

Dates

Publication Date
20260512
Application Date
20260113

Claims (10)

  1. 1. The SNP molecular marker for identifying the breeding and wild population of the Tang fish is characterized in that: The locus of the SNP molecular marker is positioned at 996 th position from 5' end of SEQ ID NO. 1, and the polymorphism is A/G.
  2. 2. Use of a substance for detecting the SNP molecular markers of claim 1 in the preparation of a product for identifying the breeding and wild populations of glabrous greenfish.
  3. 3. The use according to claim 2, characterized in that: The substance comprises a substance for use in one or more detection techniques or methods selected from the group consisting of Northern blotting, PCR, gene chip methods, nucleic acid sequencing.
  4. 4. A product comprising a substance that detects the SNP molecular marker of claim 1.
  5. 5. The product according to claim 4, wherein: The product comprises at least one of a reagent, a kit, test paper, a chip and a system.
  6. 6. The product according to claim 5, wherein: the product comprises a primer pair for amplifying the SNP molecular marker of claim 1.
  7. 7. The product of claim 6, wherein: The nucleotide sequence of the upstream primer of the primer pair is shown as SEQ ID NO. 3; The nucleotide sequences of the downstream primers of the primer pair are shown in SEQ ID NO. 2 and SEQ ID NO. 4.
  8. 8. A reagent or kit comprising the primer set according to claim 7.
  9. 9. A method for identifying and screening a breeding and wild population of Tang fish, which comprises the following steps: Extracting the DNA of the Tang fish, detecting by using the product of any one of claims 4-7 or the reagent or kit of claim 8, and obtaining an amplified product and an analysis result.
  10. 10. The method according to claim 9, wherein: the sample to be detected with the genotype G is wild Tang fish; the sample to be tested with genotype A is cultured Tang fish.

Description

Primer pair, method and application for identifying breeding and wild population of Thangustifolia based on SNP (Single nucleotide polymorphism) markers Technical Field The invention belongs to the technical fields of population genetics and molecular biology, and particularly relates to a primer pair, a method and application for identifying a breeding and wild population of Thangfish based on SNP (single nucleotide polymorphism) markers. Background Tang fish (TANICHTHYS ALBONUBES), commonly known as Bai Yunjin filaments, belongs to the genus Cyprinus, the family Cyprinus, and the genus Thalichthys, is a rare aquatic animal specific to China, and the wild population is listed as a national secondary protective animal by the national important protective wild animal directory. According to genetic structure differentiation and diversity and sources, intensity and directionality of gene flows, the Tang fish is divided into wild populations and breeding populations, and identification of species sources of the populations can be carried out through SSR, SNP, mitochondrial COI sequencing and other technologies. The wild population of the Tang fish mainly comprises a white cloud mountain population, an Dongxing population, a Huidong population, a Hainan population and the like, and is mainly distributed in Guangdong, guangxi and Hainan. Due to its ornamental and economic value, the artificial cultivation of the grass carp produces breeding lines such as yellow grass carp, large sailing grass carp, and magnificent grass carp. Single nucleotide polymorphism (single nucleotide polymorphism, SNP) refers to a polymorphism in the DNA sequence in the genome caused by a single nucleotide variation, and is one of the most widely distributed and genetically stable molecular markers. The mitochondrial genome of the Tang fish follows the strict maternal inheritance and has no recombination, multiple copies of SNP loci exist, and the evolution rate is moderate. Therefore, compared with the distinction of morphological characteristics, the SNP marker technology serving as the third generation molecular marker technology is used for designing primers to distinguish the breeding of the Thangfish from the wild population, and has the advantages of high precision and batch detection. However, the reported literature is currently divided into two general categories in Tang Yuchong groups of germplasm source identification: 1) In morphology, 8 wild populations and 2 breeding populations are analyzed by using a geometric morphology means, so that the eye diameter and head morphology are core variation points, and the judging accuracy can reach 97.6%; 2) On molecular genetics, RAPD technology, fAFLP technology, mitochondrial fragments (such as Cytb gene/D-loop), nuclear genes and microsatellite markers are mainly used, and the genetic diversity of breeding and wild populations is compared, so that primer pairs, methods and applications for accurately distinguishing the breeding and wild populations of the Tang fish based on SNP markers are not mentioned or developed. In conclusion, researches show that the Thangustifolia has hidden species, the traditional morphological means rely on the professional knowledge and experience of the appraisers, and have the defects of time consumption, labor consumption and low reliability, and the RAPD technology and the fAFLP technology need to screen and amplify a plurality of pairs of primers in advance, have large technical limitation and cannot meet the current technical requirements. Up to now, no patent has been reported for identification of germplasm sources of the grass carp breed aquatics. Disclosure of Invention The object of the first aspect of the invention is to provide SNP molecular markers for identifying breeding and wild populations of Tang fish. The object of the second aspect of the invention is to provide the use of a substance for detecting the SNP molecular markers of the first aspect of the invention for the preparation of a product for identifying the breeding and wild population of Tang fish. The object of a third aspect of the invention is to provide a product. The fourth aspect of the present invention is directed to a reagent or kit. The fifth aspect of the invention aims at providing a method for identifying and screening the breeding and wild population of the Tang fish. In order to achieve the above purpose of the present invention, the present invention adopts the following technical scheme: in a first aspect of the invention, there is provided a SNP molecular marker for identifying breeding and wild species of Tang fish, wherein the SNP molecular marker has a site located at 996 from the 5' end of SEQ ID NO. 1, and the polymorphism is A/G. In some embodiments of the invention, the sequence of the SNP molecular marker is as shown in SEQ ID NO: 1: ATGGCAAGCCTACGAAAAACTCACCCACTAATAAAAATCGCTAATGATGCACTAGTTGATTTACCAACACCATCCAATATCTCAGCATGATGAAACTTTGGATCCCTTTTAGGATTATGTT