CN-122012731-A - Chicken mitochondrial genome high-throughput sequencing method based on multiplex PCR

Abstract

The invention discloses a chicken mitochondrial genome high-throughput sequencing method based on multiplex PCR, which comprises the steps of (1) extracting genome DNA of a chicken to be detected, (2) carrying out PCR amplification by using the primer set of the invention, (3) carrying out high-throughput sequencing, and (4) detecting to obtain mutation types and haplotypes. The invention provides application of the PCR primer or the chicken mitochondrial genome multiplex PCR sequencing method in detecting different mutation types or haplotype groups.

Inventors

• LU JUNXIAN
• HUANG SHENGHAI
• JIA XIAOXU
• TANG XIUJUN
• TANG MENGJUN
• ZHANG JING
• ZHOU QIAN
• CHEN DAWEI
• YANG XINGXING

Assignees

• 江苏省家禽科学研究所

Dates

Publication Date

20260512

Application Date

20260224

Claims (10)

1. 1. A primer set for chicken mitochondrial whole genome sequencing is characterized in that the sequence of the primer set is shown as SEQ ID NO. 1-SEQ ID NO.238, primer pairs shown as SEQ ID NO. 1-SEQ ID NO.238 are divided into 2 subsets, and primer pairs with adjacent sequences are in different subsets, preferably, the primer set is divided into a primer subset 1 and a primer subset 2, wherein the primer sequences in the primer subset 1 are shown as SEQ ID NO. 1-SEQ ID NO.120, and the primer sequences in the primer subset 2 are shown as SEQ ID NO. 121-SEQ ID NO. 238.
2. 2. Use of the primer set for chicken mitochondrial whole genome sequencing of claim 1 in high throughput sequencing of chicken mitochondrial genomes.
3. 3. A method for high-throughput sequencing of chicken mitochondrial genome is characterized by comprising the steps of (1) extracting genomic DNA of chicken to be tested, (2) respectively carrying out PCR (polymerase chain reaction) amplification on the genomic DNA of a sample to be tested through the primer subsets in the claims 1 or 2, so as to obtain amplified products of different primer subsets, and mixing the amplified products of different primer subsets, and (3) carrying out high-throughput sequencing analysis.
4. 4. A method according to claim 3, wherein in step (2) the amplified products of the different primer subsets are mixed in equimolar amounts, followed by a second round of amplification with the adaptor, index sequences, and then subjected to high throughput sequencing analysis.
5. 5. The method of high throughput sequencing of chicken mitochondrial genomes of claim 4, wherein each set of PCR amplification systems of step (2) is as follows: 。
6. 6. a method of high throughput sequencing of chicken mitochondrial genomes according to claim 3, wherein each set of PCR reaction procedures of step (2) are as follows: 。
7. 7. the method of high throughput sequencing of chicken mitochondrial genomes of claim 4, wherein the second round of amplification primer pairs are: P7:CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCCTTGGCACCCGAG; P5:AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC; Wherein the italicized "X" indicates index sequence.
8. 8. The method of high throughput sequencing of chicken mitochondrial genomes of claim 4, wherein the second round of amplification system is as follows: ; The second round of PCR reaction procedure was as follows: 。
9. 9. the method for high throughput sequencing of chicken mitochondrial genomes according to any one of claims 3 to 8, wherein the sample used for extracting the genomic DNA of the chicken to be tested is blood, feathers, tissues or organs.
10. 10. Use of the method for high throughput sequencing of chicken mitochondrial genomes according to any one of claims 3-9 for detecting different mutation types and haplotypes.

Description

Chicken mitochondrial genome high-throughput sequencing method based on multiplex PCR Technical Field The invention belongs to the technical field of biology, and particularly relates to a high-throughput sequencing method for amplifying chicken mitochondrial genome based on multiplex PCR. Background The chicken genetic resource is an indispensable component of the germplasm resource and the biodiversity of livestock and poultry, and according to the 2024 edition of the national livestock and poultry genetic resource variety directory, 140 local chicken varieties in China are displayed, and the effective protection and sustainable utilization of the chicken genetic resource have profound significance for maintaining ecological balance and guaranteeing sustainable development of agriculture. Therefore, it is important to accurately evaluate the genetic diversity and identify the germplasm resources of chicken breeds. Animal cells contain two sets of genetic systems, the nuclear genome and the mitochondrial genome. Mitochondrial DNA has an independent genetic system, does not follow Mendelian genetic rules, has the characteristics of simple structure, lack of homologous recombination, high evolution rate, strict maternal inheritance and the like, and is widely applied to the fields of species origin evolution, population genetic structure, species identification, economic character association analysis and the like. Due to the high copy number nature of mitochondrial DNA, only a small number of individual samples are required to effectively reflect the genetic structure of a population. Studies have shown that chicken mitochondrial genomes are about 16785 bp a full length, comprising a D-loop control region, 13 protein-encoding genes, 2 rRNA genes (12S rRNA and 16S rRNA), and 22 tRNA genes. The mutation type of mitochondrial DNA is rich and comprises large fragment insertion/deletion, small fragment insertion/deletion, point mutation and the like, and the mutations can occur in a coding region or a non-coding region. The D-loop region has been studied by researchers at home and abroad, and the mutation rate is higher than that of other regions, but the genetic information of the whole sequence of the mitochondrial genome is more abundant. Although mitochondrial DNA is an ideal genetic marker, its sequencing technology still faces challenges. Although the traditional cesium chloride density gradient centrifugation method can obtain purer mitochondrial DNA, the process is time-consuming and labor-consuming, and the requirements on sample size and sample quality are high. Other enrichment techniques such as hybrid capture methods are costly and cumbersome to operate, and long fragment PCR methods are relatively simple to operate, but require high sample integrity. Some existing methods for mitochondrial sequencing by using multiplex PCR are difficult to obtain uniform and enough sequencing depth on the premise of ensuring complete coverage of mitochondrial genome, and some complex areas may be notched due to low amplification efficiency. Deep sequencing is required for accurate detection of low frequency mutations in mitochondria, which means that the sequencing depth must be significantly increased while ensuring sequence coverage. However, current techniques for efficiently capturing intact mitochondrial DNA and performing high throughput deep sequencing are still limited and often involve complex procedures. Therefore, development of a chicken mitochondrial DNA sequencing method capable of deep sequencing is urgently required. Disclosure of Invention The invention aims to provide a chicken mitochondrial genome sequencing primer set based on multiplex PCR and a high-throughput sequencing method. The method aims at simplifying operation steps, can obtain higher sequencing depth under the condition of meeting less data volume, and reduces sequencing cost. The invention is realized in the following way: the invention provides a primer set for chicken mitochondrial whole genome sequencing, the sequence of the primer set is shown as SEQ ID NO. 1-SEQ ID NO.238, and primer pairs shown as SEQ ID NO. 1-SEQ ID NO.238 are divided into 2 subsets, and primer pairs of adjacent sequences are in different subsets. In a specific embodiment of the present invention, the primer set is divided into a primer subset 1 and a primer subset 2, wherein the primer sequences in the primer subset 1 are shown in SEQ ID NO. 1-SEQ ID NO.120, and the primer sequences in the primer subset 2 are shown in SEQ ID NO. 121-SEQ ID NO. 238. The 119 pairs of primers of the primer set for sequencing the whole genome of the chicken mitochondria can effectively cover the whole length of the chicken mitochondria, the coverage rate is more than 99.6%, the higher sequencing depth can be obtained under the condition of extremely small data quantity, and the sequencing cost is reduced. The amplification primer can also reduce the use amount of the template. I