CN-122012739-A - SNP molecular marker related to erythroculter nigrocauda hypoxia trait and application thereof

Abstract

The invention relates to the technical field of aquatic animal molecular breeding, and discloses an SNP molecular marker related to the low-oxygen character of erythroculter nigrocauda and application thereof, wherein the sequence of the SNP molecular marker is shown as SEQ ID NO.1, the SNP molecular marker is positioned at 653 th site of the nucleotide sequence of SEQ ID NO.1, and the base of the SNP molecular marker is T or G. The method provides technical support for early breeding of the erythroculter nigrocauda and has application prospect in molecular marker assisted breeding of the erythroculter nigrocauda low-oxygen character.

Inventors

• SUN YANHONG
• CHEN JIAN
• LI PEI
• WANG QINGYUN
• LUO LIFEI
• XIA RULONG
• CHENG WEIWEI
• WEI BAOHUI

Assignees

• 武汉市农业科学院

Dates

Publication Date

20260512

Application Date

20260306

Claims (9)

1. 1. The SNP molecular marker related to the erythroculter nigrocauda hypoxia trait is characterized in that the sequence of the SNP molecular marker is shown as SEQ ID NO.1, the SNP molecular marker is positioned at 653 th position of the nucleotide sequence of SEQ ID NO.1, and the base is T or G.
2. 2. The molecular marker of the Erythroculter nigrocauda related to the hypoxia trait according to claim 1, wherein the Erythroculter nigrocauda has the strongest hypoxia tolerance when the SNP locus genotype is TT.
3. 3. A primer set for detecting SNP molecular markers associated with the erythroculter nigrocauda hypoxia trait according to any one of claims 1 to 2, wherein the primer set is as follows: F: TGAGTGCTGGGATGG; R: TGAGGCAACGGGAG。
4. 4. The method of claim 3, wherein the primer set is used for preparing a product for detecting the low oxygen resistance property of the Erythroculter nigrocauda.
5. 5. The method of claim 3, wherein the primer set is used for detecting the hypoxia tolerance of the Erythroculter nigrocauda.
6. 6. The method of claim 3, wherein the primer set is used in the genetic breeding of erythroculter nigrocauda low-oxygen-tolerant molecules.
7. 7. Use of the SNP molecular marker related to the erythroculter nigrocauda hypoxia trait according to any one of claims 1-2 in erythroculter nigrocauda hypoxia tolerant molecular genetic breeding.
8. 8. A method for detecting the hypoxia tolerance of erythroculter nigrocauda, which is characterized by comprising the following steps: (1) Taking the fin rays of the erythroculter nigrocauda, and extracting the genome DNA of the fin rays; (2) Performing PCR amplification by using the primer set of claim 3 and using genomic DNA as a template, and performing fluorescent signal scanning on the obtained amplification product; (3) Judging the genotype of the SNP locus according to the fluorescent signal, and determining the hypoxia tolerance of the erythroculter nigrocauda.
9. 9. The method for detecting the hypoxia tolerance of the erythroculter nigrocauda according to claim 8, wherein in the step (3), the hypoxia tolerance of the erythroculter nigrocauda is stronger when the genotype of the SNP locus is TT, and the hypoxia tolerance of the erythroculter nigrocauda is weaker when the genotype of the SNP locus is of other types.

Description

SNP molecular marker related to erythroculter nigrocauda hypoxia trait and application thereof Technical Field The invention relates to the technical field of molecular breeding of aquatic animals, in particular to SNP molecular markers related to the low-oxygen character of erythroculter nigrocauda and application thereof. Background Proper dissolved oxygen content of the water body is important to maintain normal physiological activities of fish. The sudden decrease of the dissolved oxygen amount of the water body often leads to the 'pond-flooding' of the culture water body, and the fishes die in a large quantity instantly, which brings urgent practical demands for the cultivation of new low-oxygen-resistant economic fishes. The Ancherythroculter nigrocauda (Ancherythroculter nigrocauda) is fish of Ancherythroculter genus of Cypriodidae of Cypriorder of Telopharyngodon ideas, commonly known as high shoulder, and is a special species in China. Under natural conditions, the erythroculter nigrocauda is carnivorous fish, mainly feeding small fish, shrimp, aquatic insects, zooplankton and the like. It is also suitable for being planted in Sichuan and Chongqing at the upstream of Yangtze river in China, and is suitable for being planted in Hubei provinces, jiangxi provinces and other provinces. The Erythroculter nigrocauda is middle-upper layer fish. The water treatment device is loved to live in water areas with fresh water quality, higher dissolved oxygen and richer plankton. Single nucleotide polymorphisms (single nucleotide polymorphism, SNPs) refer to DNA sequence polymorphisms, typically binary markers, caused by variation of a single nucleotide at the genomic level, being the most widely distributed type of genetic polymorphism markers within the genome. With rapid development of nucleic acid detection technology and massive development of genome sequence resources, SNP markers have become main molecular marker types applied in the fields of population genetic analysis, germplasm resource evaluation, economic character association analysis, molecular design breeding and the like. In the prior art, the method for developing the SNP markers related to fish hypoxia is limited to certain functional genes related to growth, the coverage of genome is very little, the number is small, and the development of effective molecular markers is very difficult. Meanwhile, reports on the molecular markers of the Erythroculter nigrocauda hypoxia-related SNP are not yet seen at present. Therefore, the molecular marker-assisted selection of the erythroculter nigrocauda with low-oxygen resistance has important significance. Disclosure of Invention Aiming at the problems in the prior art, the invention provides an SNP molecular marker related to the low-oxygen character of the erythroculter nigrocauda and application thereof. The invention provides a SNP molecular marker related to the low-oxygen character of the erythroculter nigrocauda, the SNP molecular marker is positioned at 18588931 th base of chromosome 23 of the erythroculter nigrocauda, the mutation type is T/G, The SNP molecular marker at 18588931 th base of the chromosome 23 of the erythroculter nigrum is a base sequence shown in SEQ ID NO. 1. SEQ ID NO.1: TGAGTGCTGGGATGGCAAAAACAGAGGAGAGCTCAGCCACATCTCATGCATAAAATCATGAGGTGCCTCTTTGATCTCTTCATGGGTAAAAGCCTGAACTATAGTGCCACACTTTTTTGCGTCTTCTCTAACTATTTTCATAATCGCTCGAGTAGCATAAGCCTGAATTTGGTAAATGATAATTCTGTTGATACAAGGAAGATCCTGGAGGGGATGCTGTGTTTAAAGGGTTAGTTCTCCCCAAAATTAAAAAATGTCATTAATTACTCACCTTTGTGTCGTTTCAAACTCGTAAGACTTTTGTTCATCTTCAAAACACAAATGAAGATATTTTAATGAAATCTGAGAGATGTCTCTTCCTCCATTGACTGCCTTTGCAATAACCACTTTGATGCTTCAAAAAGTTCATAAAGAGAATGTAATCCATATTAAGAATCGAGCGGTTTAGTCCAAATTTTCTAAAGAGACTCGACCGCTTTTTGTGATGAAAAGATTTAATTTATGCTTTTACTCACATGTAAACATTGATTAGCAAACATAAGCAGAAGCTCAACCGAACCTGAATAATGCACAAGAACAAACCTCTTCCAGAAGCTCAAACGTGCTGTGTAACCAATGAGGTTCATTCTTGTGTGTTACGCAGCACGTTTGATCTTCCAGAAGAGGTTTTCAGAGAGTATATCTTGATATACATATTTAGTTTGAAACTTACTTTGTGTTCTGTGTAGTATGAAATTCGGATGTACTACATCTGCCATGTTGTCACTGTCATGTGACCTACGATGTCAGTTGCGTCGCTTCACCTCCATTCATAAATCCCCTCCCGTTGCCTCA Further, when the SNP locus genotype is TT, the erythroculter nigrocauda has the strongest hypoxia tolerance. A primer set for detecting the SNP molecular marker related to the erythroculter nigrocauda hypoxia trait according to any one of the above, wherein the primer set is as follows: SEQ ID NO.2:F: TGAGTGCTGGGATGG; SEQ ID NO.3:R: TGAGGCAACGGGAG。 further, the primer group is applied to the preparation of products for detecting the low-oxygen-resistant character of the erythroculter nigrocauda. Further, the primer group is applied to the detection of the hypoxia tolerance of the erythroculter nigrocauda. Further, the primer group is applied to the genetic breeding of the erythroculter nigrocauda low-oxygen-resistant molecules. An application of the SNP molecular markers related to the erythroculter nigrocauda hypoxia traits in any one of the above in erythroculter nigrocauda hypoxia tolerant