CN-122012748-A - Application of molecular marker primer group in identifying pig backfat thickness and/or lean meat percentage
Abstract
The invention relates to the technical field of genetic breeding, in particular to application of a molecular marker primer group in identifying pig backfat thickness and/or lean meat percentage, wherein a locus of a SNP molecular marker is positioned at a 21bp position of a4 th exon of a pig DUSP1 gene with a gene version number of ENSSSCT00085019601.1, the nucleotide at the locus is G or A, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.3, the nucleotide sequence of an upstream primer of the primer group is shown as SEQ ID NO.1, and the nucleotide sequence of a downstream primer is shown as SEQ ID NO. 2. By detecting the genotype of the SNP locus, the backfat thickness and lean meat percentage of pigs can be effectively identified, a rapid and accurate molecular auxiliary breeding tool is provided for early breeding of pigs, and the improvement of lean meat percentage and the optimization of carcass quality are facilitated.
Inventors
- GAO YI
- LI NA
- YU YONGSHENG
- LIU QINGYU
- HAO TONG
- ZHANG QI
- ZHANG ZHIBIN
Assignees
- 吉林省农业科学院(中国农业科技东北创新中心)
Dates
- Publication Date
- 20260512
- Application Date
- 20260410
Claims (8)
- 1. The application of the primer group of the molecular marker in identifying the thickness and/or lean meat percentage of the pig backfat is characterized in that the locus of the SNP molecular marker is positioned at the 21bp position of the 4 th exon of the pig DUSP1 gene with the gene version number of ENSSSCT00085019601.1, and the nucleotide at the locus is G or A, and the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 3; the nucleotide sequence of the upstream primer of the primer group is shown as SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2.
- 2. The use according to claim 1, characterized by the steps of: Performing PCR amplification on the pig DNA template by using the primer group of claim 1 to obtain a PCR product; performing agarose gel electrophoresis and sequencing on the PCR product, and determining the genotype of the 21bp position of the 4 th exon of the porcine DUSP1 gene; The individuals with genotype GA have backfat thickness lower than those with genotype GG or AA and/or lean meat percentage higher than those with genotype GG or AA.
- 3. The method according to claim 2, wherein the PCR amplification is carried out using 2xTaq MasterMix 10. Mu.L of DNA 1.2. Mu.L of the upstream primer 0.4. Mu.L of the downstream primer and ddH 2 O to 20. Mu.L of the downstream primer.
- 4. The use according to claim 3, wherein the concentration of the upstream primer and the downstream primer is 10. Mu. Mol/L.
- 5. The method according to claim 2, wherein the PCR amplification is performed at 94℃for 5min, 94℃for 30s, at 55.8℃for 30s, at 72℃for 35s, for 30 cycles, at 72℃for 5min, and at 4 ℃.
- 6. Use of the primer set of claim 1 in pig breeding.
- 7. The use according to claim 6, characterized by the steps of: Performing PCR amplification on the pig DNA template by using the primer group of claim 1 to obtain a PCR product; Sequencing or gel electrophoresis analysis is carried out on the PCR product, and the genotype of the 21bp position of the 4 th exon of the porcine DUSP1 gene is determined; Individuals with genotype GA are selected as parents for breeding.
- 8. The use according to claim 1, wherein the pig is a dolok pig.
Description
Application of molecular marker primer group in identifying pig backfat thickness and/or lean meat percentage Technical Field The invention relates to the technical field of genetic breeding, in particular to application of a molecular marker primer group in identifying pig backfat thickness and/or lean meat percentage. Background With the change of market demands and the increase of complexity of cultivation environments, the conventional breeding method has difficulty in meeting the demands of modern cultivation industry. Particularly, under the background of frequent diseases, climate change and increasing requirements of consumers on pork quality, how to optimize a pig breeding scheme through scientific means, and carry out systematic genetic improvement, precise selection and environmental adaptability improvement on pig groups become the key for improving the industrial competitiveness. In the current consumer market, consumers prefer pork products with high lean meat percentage. The choice of the pig species with thin backfat has important production significance, because the backfat thickness is inversely related to the lean meat percentage, the thin backfat means that the lean meat percentage of the pig is higher, and more lean meat products meeting the market demands can be produced, thereby effectively improving the cultivation economic benefit. The backfat thickness is used as one of core breeding characters, and has definite market guidance. Therefore, in order to further improve the pork quality, a new technology capable of accurately identifying and screening the genetic potential related to the backfat thickness and lean meat percentage in early stage is needed to be developed, and the method has important significance for accelerating the genetic improvement process and realizing accurate breeding. Disclosure of Invention In order to solve the problems, the invention provides application of a molecular marker primer group in identifying the thickness and/or lean meat percentage of pig backfat. The invention is realized by the following technical scheme: The application of a primer group of a molecular marker in identifying the thickness and/or lean meat percentage of pig backfat, wherein the locus of the SNP molecular marker is positioned at the 21bp of the 4 th exon of the pig DUSP1 gene with the gene version number of ENSSSCT00085019601.1, the nucleotide at the locus is G or A, and the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 3. The nucleotide sequence of the upstream primer of the primer group is shown as SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2. SEQ ID NO. 3: GGTGGCCCAGTGGAGATCCTGCCCTTTCTCTACCTGGGGAGTGCCTACCATGCTTCTCGCAAGGACATGCTGGATGCCTTGGGTATCACTGCCTTGATCAACGTCTCGGCCAACTGTCCCAACCATTTTGAGGGTCACTACCAGTACAAGAGCATCCCCGTTGAGGACAACCACAAGGCGGACATCAGCTCCTGGTTCAATGAGGCAATCGATTTCATCG, The sequence direction is 5 '. Fwdarw.3 ', and G/A mutation exists in the base at 21bp from the 5' end, and the G/A mutation is expressed as three genotypes GG, GA or AA. Preferably, the method comprises the following steps: And (3) carrying out PCR amplification on the pig DNA template by using the primer group to obtain a PCR product. And (3) performing agarose gel electrophoresis and sequencing on the PCR product, and determining the genotype of the pig DUSP1 gene at the 21bp position of the 4 th exon. The individuals with genotype GA have backfat thickness lower than those with genotype GG or AA and/or lean meat percentage higher than those with genotype GG or AA. Preferably, the PCR amplification reaction is performed using 2xTaq MasterMix 10. Mu.L of DNA, 1.2. Mu.L of the upstream primer, 0.4. Mu.L of the downstream primer, and ddH 2 O to 20. Mu.L. Preferably, the concentration of both the upstream primer and the downstream primer is 10. Mu. Mol/L. Preferably, the PCR amplification is performed by a reaction procedure of 94℃for 5min, 94℃for 30s, an annealing temperature of 55.8℃for 30s,72℃for 35s, and 72℃for 5min, and 4℃for preservation. The primer group is applied to pig breeding. Preferably, the method comprises the following steps: And (3) carrying out PCR amplification on the pig DNA template by using the primer group to obtain a PCR product. And sequencing or gel electrophoresis analysis is carried out on the PCR product, and the genotype of the pig DUSP1 gene at the 21bp position of the 4 th exon is determined. Individuals with genotype GA are selected as parents for breeding. Preferably, the pig is a doloque pig. Compared with the prior art, the invention has the following beneficial effects: The invention provides application of a molecular marker primer group in identifying pig backfat thickness and/or lean meat percentage, wherein a locus of a SNP molecular marker is positioned at a 21bp position of a 4 th exon of a pig DUSP1 gene with a gene version number of ENSSSCT00085019601.1, the nucleotide at the locus is G or A