CN-122012750-A - Application of CNGA3 gene molecular marker g.39045A > C in Hu sheep molecular marker assisted breeding
Abstract
The invention belongs to the technical field of molecular marker assisted breeding of Hu sheep, and particularly relates to application of a CNGA3 gene molecular marker g.39045A > C in molecular marker assisted breeding of Hu sheep. The invention takes Hu sheep as a research object, adopts a method of PCR amplification, direct sequencing of products and sequence analysis to analyze CNGA3 gene polymorphism, and comprehensively analyzes the correlation between different genotypes and different growth traits of polymorphic sites. The analysis result shows that g.39045A > C is obviously related to the body length of Hu sheep, and the body length of AA genotype and CC genotype (P > 0.05) is obviously higher than that of AC genotype.
Inventors
- Shan Huili
- WANG HANGHUA
- WANG BINLEI
- HUANG XIN
- JIANG JUNFANG
Assignees
- 浙江省农业科学院
Dates
- Publication Date
- 20260512
- Application Date
- 20260413
Claims (10)
- 1. A reagent for detecting molecular markers for screening Hu sheep body length is characterized in that the molecular marker locus is g.39045A > C, wherein SNP loci are respectively marked with the gene ID=100233564 of a Mian yang reference genome, and CNGA3 gene positions on NC_056056.1:c102877356-102835910 are used as references, namely 509A > C of a genome shown in SEQ ID NO. 1; In the molecular marker g.39045A > C, the body length of the AA genotype and the CC genotype is obviously higher than that of the AC genotype.
- 2. A reagent for detecting a molecular marker for screening a Hu sheep body length according to claim 1, wherein said reagent comprises a primer pair for identifying said molecular marker.
- 3. The reagent for detecting molecular markers for screening a Hu sheep body length according to claim 1, wherein the nucleotide sequences of the primer pairs are as follows: F:5'-GGAAGCACTACACCAAGACC-3'; R:5'-CCTCCTTCTCATCCACTGTC-3'。
- 4. A kit comprising the reagent of any one of claims 1-3.
- 5. Use of the agent of any one of claims 1-3 or the kit of claim 4 for screening a Hu sheep for somatic length assisted breeding, wherein the somatic length of the AA genotype and the CC genotype is significantly higher than the AC genotype.
- 6. An application of an amplification product in screening Hu sheep body length auxiliary breeding, wherein the amplification product is obtained by amplification by adopting the reagent according to any one of claims 1-3 or the kit according to claim 4, the nucleotide sequence of the amplification product is shown as SEQ ID NO. 1, the 509 th site is A or C, and the body length of AA genotype and CC genotype is obviously higher than that of AC genotype.
- 7. A method for screening the Hu sheep body length characters is characterized by comprising the following steps of extracting Hu sheep genome DNA, carrying out PCR amplification by using primer pairs, detecting molecular markers in amplification products, and screening the Hu sheep body length characters, wherein the molecular marker loci are g.39045A > C in CNGA3 genes, the 509 th loci corresponding to SEQ ID NO. 1 are A or C, when the genotypes are AA genotypes or CC genotypes, judging that the Hu sheep to be tested is a dominant candidate of the body length, and when the genotypes are AC genotypes, judging that the Hu sheep to be tested is a dominant candidate of the non-body length.
- 8. The method for screening the Hu sheep body length trait of claim 6, wherein the nucleotide sequence of the primer pair is as follows: F:5'-GGAAGCACTACACCAAGACC-3'; R:5'-CCTCCTTCTCATCCACTGTC-3'。
- 9. The method for screening Hu sheep body length according to claim 6, wherein the PCR reaction system is 25.0. Mu.L, and comprises KOD One TM PCR MASTER Mix-Blue 12.5. Mu.L, upstream and downstream primers each 0.2. Mu.L, template 1. Mu.L, ddH 2 O11.1. Mu.L.
- 10. A method for screening Hu sheep body length according to claim 6, wherein the PCR reaction procedure comprises denaturation at 98 ℃ for 10 s, annealing at 61 ℃ for 30 s, extension at 68 ℃ for 30 s, reaction for 34 cycles, and preservation at 4 ℃ after the end of PCR.
Description
Application of CNGA3 gene molecular marker g.39045A > C in Hu sheep molecular marker assisted breeding Technical Field The invention belongs to the technical field of molecular marker assisted breeding of Hu sheep, and particularly relates to application of a CNGA3 gene molecular marker g.39045A > C in molecular marker assisted breeding of Hu sheep. Background The Hu sheep is an important local sheep variety in China, has the characteristics of good reproductive performance, high growth speed, suitability for house feeding and the like, and has high application value in mutton sheep production. The existing Hu sheep breeding work is mostly carried out on the basis of phenotypic indexes such as weight, height, body length and chest circumference, but the method generally has the problems of long measurement period, limited early selection efficiency, easiness in being influenced by feeding environment and the like. With the development of molecular marker assisted breeding technology, stable and detectable single nucleotide polymorphism sites are explored from candidate genes or genome sites related to growth traits and used for early breeding, and the development of the molecular marker assisted breeding technology has become an important technical direction for improving the breeding efficiency of Hu sheep. Reicher S et al, "A mutation IN GENE CNGA3 is associated with day blindness in sheep" to Genomics reported that sheep CNGA3 gene mutation was associated with the diurnal blind phenotype, indicating that CNGA3 gene has a clear genetic variation basis and detectability in sheep. Although the CNGA3 gene is proved to be one of candidate genes for sheep important character research, the research emphasis is on mutation related to visual dysfunction, the corresponding relation between a specific locus of the CNGA3 gene and Hu sheep provincial length characters is not involved, and a molecular marker detection system surrounding Hu sheep growth screening is not established. Therefore, further research can be carried out aiming at the relation between the CNGA3 gene and the Hu sheep body length character so as to obtain specific sites and detection means thereof which can be used for early screening of the Hu sheep growth character and molecular marker assisted breeding. Disclosure of Invention In order to study the correlation of CNGA3 gene polymorphism and Hu sheep growth character, genetic markers related to the growth character are obtained. The invention takes Hu sheep as a research object, adopts a method of PCR amplification, direct sequencing of products and sequence analysis to analyze CNGA3 gene polymorphism, and comprehensively analyzes the correlation between different genotypes and different growth traits of polymorphic sites. The invention aims to provide a reagent for detecting molecular markers for screening Hu sheep body length, wherein the molecular marker locus is g.39045A > C, wherein SNP loci are respectively referenced to the position of CNGA3 gene on Mian yang reference genome GeneID=100233564, NC_056056.1:c102877356-102835910, namely 509A > C of a genome shown in SEQ ID NO. 1; In the molecular marker g.39045A > C, the body length of the AA genotype and the CC genotype is obviously higher than that of the AC genotype. Preferably, the reagent comprises a primer pair for identifying the molecular marker. Preferably, the nucleotide sequences of the primer pairs are as follows: F(SEQ ID NO:2):5'- GGAAGCACTACACCAAGACC-3'; R(SEQ ID NO:3):5'- CCTCCTTCTCATCCACTGTC -3'。 further, it is an object of the present invention to provide a kit comprising said reagent. Further, the invention aims to provide application of the reagent or the kit in screening of Hu sheep body length auxiliary breeding, when the genotype is AA genotype or CC genotype, the Hu sheep to be detected is judged to be a dominant body length candidate, and when the genotype is AC genotype, the Hu sheep to be detected is judged to be a non-dominant body length candidate. Further, the invention aims to provide an application of an amplification product in screening Hu sheep body length auxiliary breeding, the amplification product is obtained by amplification of the reagent, a nucleotide sequence is shown as SEQ ID NO. 1, wherein the 509 th locus is A or C, when the genotype is AA genotype or CC genotype, the Hu sheep to be detected is judged to be a dominant candidate individual of body length, and when the genotype is AC genotype, the Hu sheep to be detected is judged to be a dominant candidate individual of non-body length. Further, the invention aims to provide a method for screening the Hu sheep body length characters, which comprises the following steps of extracting Hu sheep genome DNA, carrying out PCR amplification by using a primer pair, detecting molecular markers in amplification products so as to screen the Hu sheep body length characters, wherein the molecular marker loci are g.39045A > C in CNGA3 genes, and correspond to