Search

CN-122012751-A - Primer group for detecting SNP molecular markers remarkably related to fertility traits of red swamp crayfish and application of primer group

CN122012751ACN 122012751 ACN122012751 ACN 122012751ACN-122012751-A

Abstract

The invention belongs to the technical field of biological molecular markers, and particularly relates to a primer group for detecting SNP molecular markers obviously related to the fertility traits of red swamp crayfish and application thereof. The primer group can quickly and effectively realize accurate typing of the SNP locus of the vitellogenin Vg gene of the red swamp crayfish, detection can be completed by conventional PCR and agarose gel electrophoresis, the detection flow is simple and convenient, the time consumption is short, the cost is low, and the primer group is suitable for large-scale and high-throughput parent screening. The marker is obviously associated with fertility characters such as egg holding quantity of the red swamp crayfish, the parting result is stable and reliable, the repeatability is good, only tail fan tail end sampling is needed, dissection is not needed, genotype identification can be completed in early seedling raising, the breeding period is greatly shortened, the high fertility parent screening efficiency is improved, the problems of long breeding period, low efficiency and the like of the traditional phenotype are effectively solved, a stable and practical molecular tool is provided for the improvement and efficient breeding of the germplasm of the red swamp crayfish, and the marker has important industrialized application value.

Inventors

  • CHI MEILI
  • GAO SAISAI
  • CHENG SHUN
  • LI FEI
  • LI MENG
  • ZHANG CONGKUI

Assignees

  • 浙江省淡水水产研究所(浙江省淡水渔业环境监测站)
  • 浙江星奥农业科技有限公司

Dates

Publication Date
20260512
Application Date
20260413

Claims (10)

  1. 1. A primer set for detecting SNP molecular markers significantly associated with the fertility trait of red swamp crayfish, comprising: The nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, and specifically CGAAGTGCTAGGACCAT; the nucleotide sequence of the downstream primer is shown as SEQ ID NO.2, specifically TGTGGGAATGGAGGAGC; the SNP-A primer has a nucleotide sequence shown as SEQ ID NO.3, and specifically comprises CTCCCCAGTGGACTTGTCATA; the SNP-G primer has a nucleotide sequence shown as SEQ ID NO.4, and specifically GCAGAGATAATGATTGTGGAAAGC.
  2. 2. The primer group for detecting the SNP molecular markers remarkably related to the fertility traits of the red swamp crayfish according to claim 1, wherein the nucleotide sequence of the SNP molecular markers is shown as SEQ ID NO.5, and the 6451 th site of the nucleotide sequence has A > G mutation and is divided into three genotypes of AA, AG and GG.
  3. 3. Use of the primer set for detecting the SNP molecular markers significantly associated with the fertility trait of red swamp crayfish according to claim 1 or 2 for detecting the fertility trait of red swamp crayfish, comprising the steps of: s1, extracting genomic DNA of the red swamp crayfish to be detected, and carrying out tetra-PRIMER ARMS-PCR amplification reaction of SNP by using the primer set for detecting SNP molecular markers remarkably related to the fertility traits of the red swamp crayfish according to claim 1 or 2; And S2, carrying out electrophoresis on the amplified product to obtain a detection result, and judging the genotype of the 6451 th site of the genome DNA.
  4. 4. The use according to claim 3, wherein the genomic DNA in S1 is the procambarus clarkia vitellogenin gene.
  5. 5. The use according to claim 4, wherein the genomic DNA in S1 is collected from the ovarian tissue of the procambarus clarkia to be tested.
  6. 6. The method according to claim 3, wherein the tetra-PRIMER ARMS-PCR reaction system in S1 is a 25. Mu.L system comprising 12.5. Mu.L PCR Mix, 4. Mu.L primer system, 7.0. Mu.L H 2 O, 1. Mu.L gDNA and 0.5. Mu.L Taq DNA polymerase, wherein the primer system comprises 0.7. Mu.L upstream primer, 0.7. Mu.L downstream primer, 1.3. Mu.L SNP-A primer and 1.3. Mu.L SNP-G primer.
  7. 7. The method of claim 3, wherein the PCR reaction in S1 is performed by a process comprising the steps of pre-denaturation at 94℃for 5min, 40 cycles of reaction at 72℃for 10min and 4℃for infinity, wherein the cycles of reaction comprise 94℃for 30S, 60℃for 30S, 72℃for 30S.
  8. 8. The method according to claim 3, wherein the step of obtaining the detection result by agarose gel electrophoresis in S2, the reaction band is typed, the reaction band comprises a control band and a target band, the target band comprises at least one of an A-type band and a G-type band, and the typing of the detection result comprises: If a control band with the size of 541bp and an A-type band with the size of 399bp appear, the 6451 bit is AA-type; If a control band with the size of 541bp and a G-type band with the size of 186bp appear, the 6451 bit is GG type, If a control band of 541bp in size and an A-type band of 399bp in size and a G-type band of 186bp in size appear, it indicates that the 6451 position is AG type.
  9. 9. The method according to claim 3, wherein the nucleotide sequence of the control band is shown in SEQ ID NO.6, the nucleotide sequence of the SNP molecular marker A-type band is shown in SEQ ID NO.7, and the nucleotide sequence of the SNP molecular marker G-type band is shown in SEQ ID NO. 8.
  10. 10. Use of the primer set for detecting SNP molecular markers significantly associated with the fertility trait of red swamp crayfish according to claim 1 or 2 in a kit.

Description

Primer group for detecting SNP molecular markers remarkably related to fertility traits of red swamp crayfish and application of primer group Technical Field The invention belongs to the technical field of biological molecular markers, and particularly relates to a primer group for detecting SNP molecular markers obviously related to the fertility traits of red swamp crayfish and application thereof. Background The red-chelating crayfish (Cherax quadricarinatus) belongs to the genera of the crustacean, the octopoda, the procambarus clarkia and the procambarus, commonly called as the Australian freshwater lobster, the Australian microcytone and the like, belongs to the large benthic freshwater shrimps, has strong capability of resisting hypoxia, ammonia nitrogen and the like, is large in individual and high in unit price, becomes a preferred variety for comprehensive planting and breeding in ponds and paddy fields in recent years, and has higher market value. However, compared with other freshwater shrimps, the red-chelating crayfish has slow industrialized development, and the phenomenon is mainly caused by the fact that the high-quality high-fertility parent is insufficient, and the offspring egg holding quantity is degraded year by year due to the self-propagation population without breeding in multiple generations. Secondly, the red-chelating crayfish has large egg grains, small egg holding quantity, long egg holding time, poor egg grain quality and easy mildew and falling off when the nutrition is insufficient. Thirdly, the breeding progress of the gene level is difficult to obtain only through the distinction of the egg holding quantity due to the loss of the molecular markers of the fertility breeding. Therefore, improving the breeding level of parent red-clarkia and comprehensively improving the egg holding capacity are key factors for accelerating the development of red-clarkia industry. The current method for strengthening the fecundity of the red crayfish mostly adopts the physiological property screening and strengthening cultivation of parents, for example, the prior Chinese patent CN112136738B is a high egg holding capacity red crayfish parent screening and breeding method, which indirectly selects the egg holding capacity of the red crayfish by using the morphological property related to the egg holding capacity, which takes the first abdominal width/full length as an index to replace the egg holding capacity index, as a breeding index, and indirectly adjusts the specification proportion and the matched number of male and female parent crayfish, thereby solving the difficulties that the egg holding capacity cannot be measured in advance, the egg holding parent crayfish is not suitable to be excessively operated, the egg holding rate is low and the like in actual production, providing a technical scheme for establishing the high-yield parent population of the red crayfish, and laying a foundation for realizing the large-scale cultivation of the red crayfish. But can not provide stable support for breeding and breeding of the red swamp crayfish on the gene level. As a third generation molecular marker, single nucleotide polymorphism (Single nucleotide polymorphism, SNP) can realize high-throughput and automatic screening detection, and has wide application range. Population genetic diversity analysis has been carried out in various shrimps such as penaeus monodon, litopenaeus vannamei, macrobrachium nipponensis, procambarus clarkii and the like. Tetra-PRIMER ARMS-PCR (four-primer amplified hindered mutation system PCR) is to utilize four different primers, and the mutation of a sample can be obtained in a conventional laboratory through 1 PCR reaction by detecting the existence and the length of a specific amplified product fragment, and in the prior art, SNP of the penaeus monodon ALFPm gene is developed by utilizing Tetra-PRIMER ARMS-PCR technology to carry out genotyping, the correlation of the SNP with white spot syndrome virus resistance is explored, and the analysis of 2 SNP loci screened on the Chinese soft-shelled turtle IGF2 gene is found to have the potential of being used as auxiliary breeding of Chinese soft-shelled turtle growth trait molecular markers. For the red swamp crayfish, chinese patent CN117904268B is a SNP molecular marker for identifying the genetic sex of the red swamp crayfish and application, which is mainly focused on the identification of the genetic sex of the red swamp crayfish, but the molecular marker which is obviously related to the fertility character is not revealed, and the molecular marker cannot provide powerful support for breeding. Vitellogenin (Vitellogenin, vg) is used as a core molecule for regulating reproductive performance, and the expression mode of the vitellogenin is highly synchronous with the gonadal development process, and can be used as an effective indicator of gonadal development. In terms of ovum quality control, the Vg content directly