Search

CN-122012754-A - Pig lactation performance related molecular marker and application thereof in breeding

CN122012754ACN 122012754 ACN122012754 ACN 122012754ACN-122012754-A

Abstract

The invention relates to a molecular marker related to pig lactation performance, wherein SNP loci of the molecular marker correspond to A/G mutation of 25241438 th base polymorphism loci from the 5 ́ tail end on chromosome 7 of a pig reference genome Sscoffa 11.1 of GenBank database, and the polymorphism of the loci leads to different pig lactation power, wherein when single nucleotide of the SNP loci is A, the pig lactation power is high, and when single nucleotide of the SNP loci is G, the pig lactation power is low. The method can be used for early screening of the pigs to be selected, can reduce breeding cost, has high accuracy and low detection cost, can realize automatic detection, and has high application value in the aspect of pig breeding.

Inventors

  • SHI LIJUN
  • LI HUIHUI
  • WANG LIXIAN

Assignees

  • 中国农业科学院北京畜牧兽医研究所

Dates

Publication Date
20260512
Application Date
20260415

Claims (10)

  1. 1. A molecular marker related to pig lactation performance is characterized in that SNP loci of the molecular markers correspond to A/G mutation of 25241438 th base polymorphism loci from the 5 ́ tail end on chromosome 7 of Sscoffa 11.1 of pig reference genome of GenBank database, the polymorphism of the loci leads to different pig lactation power, wherein when single nucleotide of the SNP loci is A, the pig lactation power is high, and when single nucleotide of the SNP loci is G, the pig lactation power is low.
  2. 2. The molecular marker related to the lactation performance of pigs according to claim 1, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, and M in the sequence is A or G.
  3. 3. The molecular marker related to the lactation performance of pigs according to claim 1, wherein the primer pair for detecting the molecular marker comprises an upstream primer U and a downstream primer D: U:5’- GGACATCAAGAACACCTGGGT -3’,SEQ ID No.2; D:5’- GCTCCCCCTTTCCAGTCATC -3’,SEQ ID No.3。
  4. 4. the molecular marker related to lactation performance of pigs of claim 3, wherein the kit for detecting the molecular marker comprises the primer pair of claim 3.
  5. 5. The molecular marker of claim 4, wherein the pig comprises white pig and its synthetic line.
  6. 6. The molecular marker related to the lactation performance of pigs according to claim 1 or 2, wherein the method for identifying the lactation performance of the pigs comprises the following steps: Detecting SNP loci of the molecular markers in the claim 1 or 2 on a chromosome 7 of the pig, judging the lactation power of the pig according to the genotypes of the SNP loci, wherein the AA genotypes of the SNP loci are higher than those of the AG genotypes, and the AG genotypes of the pig are higher than those of the GG genotypes; the pig with the AA genotype is a pig with the 25241438 th base A from the tail end of 5 ́ on a 7 th chromosome of a pig reference genome Srcrofa 11.1; the pig of the AG genotype is a pig with the A and G bases from the 5 ́ tail end to the 25241438 th base on the 7 th chromosome of the pig reference genome Srcrofa 11.1; The pig of the GG genotype is a pig with G as a 25241438 th base from the tail end of 5 ́ on a 7 th chromosome of a pig reference genome Sscofa 11.1; The Srcrofa 11.1 pig reference genome sequence is GenBank database pig reference genome sequence.
  7. 7. The molecular marker related to the lactation performance of pigs according to claim 1 or 2, wherein the method for breeding the pig breeds with high lactation performance comprises the following steps of detecting SNP loci of the molecular marker of claim 1 or 2 on chromosome 7 of pigs, eliminating individuals with single nucleotide G of the SNP loci, and keeping individuals with single nucleotide A of the SNP loci as breeding pigs, wherein the pigs comprise white pigs and synthetic lines thereof.
  8. 8. The molecular marker related to lactation performance of pigs according to claim 3 or 4, wherein the detection method comprises the following steps of (1) extracting genome DNA of the pigs to be detected; (2) Using the primer pair of claim 3 or the primer pair of the kit of claim 4 as an amplification primer, and using the genome DNA of the pig to be detected obtained in the step (1) as a template DNA to perform PCR amplification to obtain a PCR amplification product; (3) Performing first-generation Sanger sequencing on the PCR amplification product to obtain a sequencing result; (4) Based on the sequencing results, the genotype is determined.
  9. 9. The molecular marker according to claim 1 or 2, wherein the method for genetically modifying pigs comprises the steps of determining the molecular marker according to claim 1 or 2 of the pigs in the core group of the pigs, and making corresponding selection according to the molecular marker, wherein the breeding pigs are bred with reference genome Srcrofa 11.1, the individuals of the breeding pigs with the 25241438 th base from the 5 ́ tail end being of AA or AG genotype on the 7 th chromosome of the breeding pigs, and the individuals of the GG genotype at the point are eliminated, so that the frequency of the allele A at the point is increased in a generation-by-generation mode, thereby improving the lactation capacity of offspring pigs, and the pigs comprise large white pigs and synthetic lines thereof.
  10. 10. The application of the molecular marker related to the lactation performance of pigs in breeding is characterized in that the molecular marker of claim 1 or 2 is used for breeding pig breeds with high lactation performance.

Description

Pig lactation performance related molecular marker and application thereof in breeding Technical Field The invention belongs to the technical field of pig genetic marker screening in molecular biology, and particularly relates to a molecular marker related to the lactation performance of pigs, a detection primer and application thereof. Background The lactation capacity of pigs is a key index for measuring the reproductive performance and the feeding capacity of sows, and directly influences the survival rate of piglets, the weaning weight and the overall economic benefit of a pig farm. However, pig lactation is a complex quantitative trait whose phenotype is difficult to measure directly and accurately. At present, the evaluation is mainly carried out by measuring indirect indexes such as weaning litter weight, daily gain and the like of piglets. The evaluation method is time-consuming and labor-consuming, is interfered by various environmental factors such as sow embryo times, nutrition levels, feeding management and the like, and cannot accurately reflect the genetic potential of the sow, so that the traditional breeding method has low efficiency in selecting high-lactation-ability breeding pigs and has slow genetic progress. With the development of molecular biology technology, molecular marker assisted selection has become an important tool for improving livestock breeding efficiency. The core is to find genetic markers closely linked to the target trait or having causal effects. If the molecular marker obviously related to the lactation capacity of the pigs can be found and applied to breeding practice, the lactation capacity of the pigs can be accurately predicted through genotype detection under the conditions of early growth and no environmental influence of the pigs, so that early and accurate breeding is realized, the breeding process of high-lactation-capacity pig varieties is obviously accelerated, and the molecular marker has important significance for improving the core competitiveness of the pig industry. Disclosure of Invention In order to overcome the defects in the prior art, the primary aim of the invention is to provide a molecular marker related to the lactation performance of pigs and application thereof in breeding so as to solve the problems in the prior art. The invention further aims at providing a molecular marker related to pig lactation performance, wherein the SNP locus of the molecular marker corresponds to an A/G mutation of 25241438 th base polymorphism locus from the tail end of 5 ́ on chromosome 7 of a pig reference genome Sscoofa 11.1 of GenBank database, the polymorphism of the base loci causes different pig lactation power, wherein when the SNP locus single nucleotide is A, the pig lactation power is high, and when the SNP locus single nucleotide is G, the pig lactation power is low. Further, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, wherein M in the sequence is A or G. Further, the primer pair for detecting the molecular marker includes an upstream primer U and a downstream primer D: U:5’- GGACATCAAGAACACCTGGGT -3’,SEQ ID No.2; D:5’- GCTCCCCCTTTCCAGTCATC -3’,SEQ ID No.3。 further, a kit for detecting the molecular marker comprises the primer pair of claim 3. Further, the pigs include white pigs and synthetic lines thereof. Further, the method for identifying the lactation performance of the pigs comprises the following steps of detecting SNP loci of the molecular markers in the claims 1 or 2 on chromosome 7 of the pigs, judging the lactation performance of the pigs according to the genotypes of the SNP loci, wherein the AA genotypes of the SNP loci have higher lactation performance than the AG genotypes of the pigs, and the AG genotypes of the pigs have higher lactation performance than the GG genotypes of the pigs; the pig with the AA genotype is a pig with the 25241438 th base A from the tail end of 5 ́ on a 7 th chromosome of a pig reference genome Srcrofa 11.1; the pig of the AG genotype is a pig with the A and G bases from the 5 ́ tail end to the 25241438 th base on the 7 th chromosome of the pig reference genome Srcrofa 11.1; The pig of the GG genotype is a pig with G as a 25241438 th base from the tail end of 5 ́ on a 7 th chromosome of a pig reference genome Sscofa 11.1; The Srcrofa 11.1 pig reference genome sequence is GenBank database pig reference genome sequence. Further, the method for breeding the pig breeds with high lactation capacity comprises the following steps of detecting the SNP locus of the molecular marker of claim 1 or 2 on chromosome 7 of the pig, eliminating individuals with single nucleotide of the SNP locus being G, and keeping the individuals with single nucleotide of the SNP locus being A as breeding pigs, wherein the pigs comprise white pigs and synthetic lines thereof. Further, the detection method comprises the following steps: (1) Extracting genome DNA of a pig to be detected; (2) Using the primer pair o