Search

CN-122012755-A - Chicken FMNL gene promoter region molecular marker, detection reagent and application thereof

CN122012755ACN 122012755 ACN122012755 ACN 122012755ACN-122012755-A

Abstract

The invention discloses a chicken FMNL gene promoter region molecular marker, a detection reagent and application thereof, belonging to the technical field of molecular genetics. According to the invention, two SNP loci which are obviously related to egg laying performance are identified in a promoter region of a chicken FMNL gene, are commonly found in a plurality of chickens of different varieties, and show consistent effect trends among different genotypes. Based on the SNP locus identified by the invention, the invention develops and designs a chicken FMNL gene promoter region molecular marker and a corresponding detection reagent. Can realize accurate identification of the early age of the laying hen and the laying property, and has important significance for breeding the high-yield laying hen.

Inventors

  • JIANG YUNLIANG
  • Shu Xinmei
  • LIAN LETIAN
  • ZHANG HONGRUI
  • KANG LI
  • SUN YI
  • WEI QINGQING

Assignees

  • 山东农业大学

Dates

Publication Date
20260512
Application Date
20260416

Claims (9)

  1. 1. A molecular marker of a chicken FMNL1 gene promoter region is characterized in that a nucleotide sequence of the molecular marker of the chicken FMNL1 gene promoter region is shown as SEQ ID NO.1, a 136 th base from a 5 'end of the sequence is a SNP1 site, the base polymorphism is T or G, a 538 th base from the 5' end of the sequence is a SNP2 site, and the base polymorphism is G or A.
  2. 2. The molecular marker of the promoter region of the chicken FMNL gene according to claim 1, wherein the SNP1 site is GG genotype and the SNP2 site is AA genotype, corresponding to earlier day of laying and more egg numbers.
  3. 3. A detection reagent is characterized by comprising a primer pair for detecting the molecular marker of the chicken FMNL gene promoter region according to claim 1, wherein the nucleotide sequences of the primer pair are shown as SEQ ID NO.2 and SEQ ID NO. 3.
  4. 4. The detection reagent according to claim 3, wherein the detection reagent is a PCR sequencing kit or a KASP typing kit.
  5. 5. The application of the chicken FMNL gene promoter region molecular marker in claim 1 or 2 in breeding hens with early-open-day-old and multi-egg-number-of-laid traits.
  6. 6. Use of the detection reagent according to claim 3 in (1) or (2) as follows: (1) Identifying egg laying characteristics of hens; (2) Breeding hen with early-age and multiple egg-laying number.
  7. 7. The use according to claim 6, wherein the egg laying trait comprises the age of the open day, the number of eggs laid during the egg laying ramp, or the total number of eggs laid at 43 weeks of age.
  8. 8. The use according to claim 6, wherein the method for breeding hens with early-age-on-production and multiple-number-of-eggs traits is: The method comprises the steps of taking genome DNA of a hen to be detected as a template, carrying out PCR amplification by using primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain an amplification product, sequencing the amplification product, identifying the egg laying characteristics of the hen according to the sequencing result, and breeding the hen with early open-producing days and multiple egg laying quantity characteristics.
  9. 9. The method according to claim 8, wherein the amplification product is identified as having early day of open production and quantitative multiple traits of egg production if the sequencing result of the amplification product corresponds to the nucleotide 136 of the sequence shown in SEQ ID NO.1 being GG genotype and the nucleotide 538 being AA genotype.

Description

Chicken FMNL gene promoter region molecular marker, detection reagent and application thereof Technical Field The invention relates to the technical field of molecular genetics, in particular to a chicken FMNL gene promoter region molecular marker, a detection reagent and application thereof. Background Egg laying performance is a core index for measuring the production benefit of poultry and is directly related to the economic benefit of the breeding industry. The development, maturation and ovulation processes of follicles are regulated by complex networks of diverse genes. The functional genes and genetic variation related to chicken egg laying characteristics are deeply studied, and the molecular marker assisted breeding process of the high-yield layer variety is facilitated to be accelerated. FMNL1 (Formin-like protein 1) is an important member of the Formin family and is widely involved in cell processes such as cytoskeletal remodeling, cell migration, cell polarization, cell division, and the like. Studies show that FMNL a is highly expressed in immune cells and is involved in the processes of immune synapse formation, phagocytosis, migration and the like. Furthermore, it has been found that FMNLl co-localizes with the golgi complex and is able to maintain the structure of the golgi (colban-Franco et al, 2011). In mice FMNL1 is involved in the maturation process of oocytes by modulating dynamic changes in the cytoskeleton (Wang Fei, 2015). However, studies on FMNL in chicken follicular development, granulosa cell function and egg laying performance are still very limited. Single nucleotide polymorphism (single nucleotide polymorphism, SNP) refers to a polymorphism in the DNA sequence at the genomic level caused by variation of a single nucleotide, and is an important source for genetic variation between individuals. The major manifestations of SNPs include four types of transversions, insertions, transitions and deletions of bases, which variant forms play a key role in biological evolution (brooks et al 1999). SNPs may be located in coding regions, affecting amino acid sequence and protein function, or in non-coding regions, such as promoter regions, affecting gene expression. Although SNPs are numerous and widely distributed, only a few SNPs that are significantly associated with biological traits have breeding application value. At present, research on the correlation between FMNL gene promoter region SNP and chicken egg laying performance has not been reported, so that research on FMNL gene promoter region SNP is helpful for screening out molecular markers with breeding value, and provides theoretical basis and technical support for molecular marker-assisted breeding of high-yield laying hens. Disclosure of Invention Aiming at the prior art, the invention aims to provide a chicken FMNL gene promoter region molecular marker, a detection reagent and application thereof. In order to achieve the above purpose, the invention adopts the following technical scheme: According to a first aspect of the invention, a chicken FMNL gene promoter region molecular marker is provided, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, the 136 th base from the 5 'end of the sequence is an SNP1 site, the base polymorphism of the nucleotide is T or G, the 538 th base from the 5' end of the sequence is an SNP2 site, and the base polymorphism of the nucleotide is G or A. The nucleotide of the chicken FMNL gene promoter region molecular marker is specifically as follows: TACAGAGCTGTGCCAGCGACCTGCGGGCAGAGCTGTGCCGCTCTGTGTCGCGTTGACAGCTCAGCCCTGCGAGTGGCGGCCCCCAGGGCCCAGCTTATACCCCAGATCACGTGAAACGCTGCTCTGTGCAAAAGGT/G(SNP1)ACACAGCCCAGTGCACGGCCCTCACTTGGTGCCGTGCTGCCATTGCTCTCCTCCCATCATCATTGCCCTCCCTATGGCCAGGAATCGGGAGCACGGGCCTCATCTCTGCCTTTCCTGGTGGTTGAGGCTCTCAGCTTTCCCCTGTGTCACCTCCCTGCTCTGCCCTGGTCAGCACACTGCTCTGCTGGCACTTGGCCTTGATGTGGGGCATCCTTCAAGGGATGGCACTTCTCCTTGGTGTGGGGCACCCCACAGCCAGGAGAGCCCCTCTGGCTCCTTGGGGTCACAGCCTGGCCCAGTGGGCAGCCTGGGGCTCATCTTTGGGCCTGTTTTCCATGCTGGGTCTCCTGCACAGGCAGACTCTGTTCTCGTCCTGTACCCCAGCTGGGATCAAGGCAAGCG/A(SNP2)GATCTGTTCAAACAGGATCTTAGGGAATTGCATGCAAAATATTTAGTGAAATGATGAAATATTTAGTGAAACTAAGATATTTAAACTGCAAAGTCAAGCTCTGGAATGTCAGAATGTACTGTAATGTGGGTGACCCCA. note that the nucleotide in bold italics in the sequence is a SNP site, represented in the sequence listing as the corresponding degenerate base. Wherein the degenerate base of T/G is K and the degenerate base of G/A is R. In the invention, 2 SNP loci which are obviously related to the egg laying performance of hens are found in the promoter region of a chicken FMNL Gene (Gene ID: 419965). The physical positions corresponding to the 2 SNP loci are as follows: SNP1 has a physical position of 27_3773331, a base polymorphism of T or G, and dominant alleles related to open day of Age (AFE), number of eggs laid in the rising period (EN 1) and total number of eggs laid in the 43 week of age (E43) are G, GG genotypes correspond to earlier open day of age an