CN-122012759-A - Primer probe combination for rapidly detecting mycoplasma synoviae of chickens based on fluorescence MIRA method and detection method thereof

Abstract

The invention discloses a primer probe combination for rapidly detecting chicken bursa mycoplasma based on a fluorescence MIRA method and a detection method thereof, belonging to the technical field of biological detection. The invention discloses a method for rapidly detecting chicken bursa mycoplasma based on a fluorescence MIRA method, which comprises the steps of extracting DNA of a sample to be detected by a boiling method, carrying out isothermal amplification by using a primer probe combination, and judging the result. The method has the advantages of strong specificity, high sensitivity, good repeatability, simple and quick operation, no dependence on professional technicians, specific instruments and equipment and the like, is suitable for basic level and field application, can quickly detect the mycoplasma synoviae, and provides a high-efficiency and accurate detection method for judging mycoplasma synoviae infection in production.

Inventors

• WEI TIANCHAO
• SUN JIAWEN
• QIN ZIJIN
• LI PEIYING
• Zeng Jianluo
• HUANG ZHENXING
• HUANG JIANNI
• MO MEILAN

Assignees

• 广西大学

Dates

Publication Date

20260512

Application Date

20260210

Claims (5)

1. 1. A primer probe combination for rapidly detecting chicken bursa mycoplasma based on a fluorescence MIRA method is characterized in that the primer probe combination has the following sequence: an upstream primer CTGAACCAACACCTGGAAACCCAAATACTG; a downstream primer AATCTCTGGCTTCAGCTTCTGTTGTAGTTG; And (3) probe: CCAGGAGGTGGTACAGTTGACCCTGTAGAGGC[FAM-dT][THF]C[BHQ1-dT]AAAACAGAAGCTA-C3-spaser。
2. 2. a method for rapidly detecting mycoplasma synoviae of chickens based on a fluorescence MIRA method without aiming at disease diagnosis, which is characterized by comprising the following steps: (1) Extracting DNA of a sample to be detected by a boiling method; (2) Performing isothermal amplification using the primer probe combination of claim 1; (3) And (3) judging the result, namely carrying out biological analysis on the difference value between the reaction end point fluorescence value and the initial fluorescence value of the test group and the difference value between the reaction end point fluorescence value and the initial fluorescence value of the negative control group, wherein if the difference exists, the detection result is positive, and if the difference exists, the detection result is negative, or if the difference exists, the detection result is positive after fluorescent development under ultraviolet light, and if the difference exists, the detection result is negative.
3. 3. The method of claim 2, wherein the sample to be tested in step (1) is a chicken throat swab, a palate crack swab, a tracheal swab, or joint contents.
4. 4. The method according to claim 2, wherein the step (1) of extracting DNA of the sample to be detected by the boiling method comprises the steps of placing the collected swab in a 37 ℃ incubator for 30min, shaking for 30s by a vortex instrument to fully release pathogens, sucking in though inner liquid, adding the inner liquid into a new 1.5mL sterile centrifuge tube, centrifuging for 5min 12000r/min, discarding supernatant, adding 1mL 1 XPBS for resuspension, shaking for uniform mixing, centrifuging for 5min 12000r/min again, discarding supernatant, repeating the washing twice according to the step, then resuspension with 50 μL1 XPBS, heating in a 100 ℃ water bath for 8min, immediately cooling for 5min after the heating, centrifuging for 5min 12000r/min at the end, and centrifuging for 5min supernatant as genomic DNA.
5. 5. The method according to claim 2, wherein the isothermal amplification system of step (2) comprises buffer A29.4. Mu.L, 10. Mu.M upstream and downstream primer 1.5. Mu.L, 10. Mu.M probe 1.2. Mu.L, template 5. Mu. L, ddH 2 O8.9. Mu.L, and buffer B2.5. Mu.L; the isothermal amplification procedure was performed at 39℃for 20min, and fluorescence was collected every 30 s.

Description

Primer probe combination for rapidly detecting mycoplasma synoviae of chickens based on fluorescence MIRA method and detection method thereof Technical Field The invention relates to the technical field of biological detection, in particular to a primer probe combination for rapidly detecting mycoplasma synoviae based on a fluorescence MIRA method and a detection method thereof. Background Mycoplasma synoviae (Mycoplasma Synoviae, MS) is a cell-free wall, a microorganism with a size between bacteria and viruses. MS mainly causes infectious synovitis of joints and tendon sheaths, and can also cause subclinical respiratory tract infection, eggshell tip abnormality syndrome and egg drop, and mixed infection is easy to occur with escherichia coli, avian influenza virus and avian infectious bronchitis virus. The chicken infected by MS has good early mental state and normal diet, but along with the development of the disease course, the sick chicken has symptoms of joint swelling, lameness, anorexia, slow growth, cockscomb, and rough feathers, and the healthy development of the poultry industry is seriously affected. Since the clinical symptoms of MS infection are mostly subclinical, laboratory diagnosis of MS is necessary. Laboratory diagnosis of MS includes isolation and identification, serological detection, and molecular biological detection. MS has strict requirements on in-vitro culture conditions, long culture time and great difficulty, and serological detection can only detect later infection and is easy to cause false positive and cross reaction. Current molecular biological methods for MS detection include conventional Polymerase Chain Reaction (PCR), real-time fluorescent quantitative PCR (qPCR), high resolution melting curve (HRM), loop-mediated isothermal amplification (LAMP), and the like. Although the molecular biology detection method avoids the problems of long time and high cost required by separation culture, the method has certain personnel and environment requirements, most of required instruments are expensive, limited in field, low in sensitivity and difficult to popularize and apply in basic detection laboratories such as livestock and poultry breeding sources or farmer markets. Multi-enzyme isothermal amplification (Multi-enzyme isothermal rapid amplification, MIRA) is a novel isothermal nucleic acid amplification method developed on the basis of recombinase-mediated nucleic acid amplification (Recombinase polymerase amplification, RPA) technology. MIRA is based on organism recombination repair mechanism, and can realize amplification at 39 ℃ for 20 minutes by utilizing recombinase, single-chain binding protein, DNA polymerase and the like in vitro. The fluorescent MIRA method is a detection means for realizing real-time observation of amplification results by adding fluorescent groups on probes on the basis of MIRA principle, and the method can observe the results in real time only by a simple constant-temperature fluorescent detector or ultraviolet color development. The method has the advantages of low temperature requirement, simple equipment requirement, short amplification time, high sensitivity and the like, and is suitable for on-site instant detection. Therefore, providing a primer probe combination for rapidly detecting chicken bursa mycoplasma based on a fluorescence MIRA method and a detection method thereof are problems to be solved by those skilled in the art. Disclosure of Invention In view of the above, the invention provides a primer probe combination for rapidly detecting chicken bursa mycoplasma based on a fluorescence MIRA method and a detection method thereof, and particularly provides an MS detection method with strong specificity and high sensitivity based on a MIRA technology. The method is convenient and quick, has simple equipment requirement and is suitable for popularization and application. The method can detect the mycoplasma synoviae within 30 minutes under the constant temperature condition, does not need complex instruments and equipment, and has strong specificity and high sensitivity. In order to achieve the above purpose, the present invention adopts the following technical scheme: a group of specific primers and probes are designed according to vlhA genes of MS, isothermal amplification is carried out for 20 minutes at 39 ℃ by utilizing MIRA technology, and MS is detected according to fluorescence value or blue light color development. A specific primer probe combination for rapid detection of MS comprising: the upstream primer is CTGAACCAACACCTGGAAACCCAAATACTG, and SEQ ID NO.3. The downstream primer AATCTCTGGCTTCAGCTTCTGTTGTAGTTG and SEQ ID NO.7. Fluorescent probe: CCAGGAGGTGGTACAGTTGACCCTGTAGAGGC[FAM-dT][THF]C[BHQ1-dT]AAAACAGAAGCTA-C3-spaser。 The 33 th base T of the fluorescent probe from the 5 'end is modified by a FAM group, the 34 th base G is replaced by THF, the 36 th base T is modified by a BHQ1 group, and the 3' end is modified by C3 spacer bl