CN-122012766-A - Detection gene of eimeria coccidium of pig and fluorescent quantitative PCR detection kit and preparation method thereof
Abstract
The invention relates to the technical field of biology, in particular to a detection gene of eimeria coccidium in pigs, a fluorescent quantitative PCR detection kit and a preparation method thereof. The kit prepared by the detection gene cox 1 of the eimeria of the pig with the conserved sequence:AGCTAATTGGTACCTTCCATTCTTACTGGTGGATTATTAATGCTAGTATTAGACTTACATCTAAATACTCAATTCTACGATGCATCATTTAATGGTGATCCAGTTCTATACCAACAA; through the cox 1 gene and the SYAB Green fluorescent quantitative PCR detection reagent has the characteristics of high sensitivity, strong specificity and good repeatability when being used for detecting the eimeria of the pig.
Inventors
- LIN QING
- KANG YUKUN
- LI YAQING
- Xiao Yefang
- SONG JUNKE
Assignees
- 西北农林科技大学
Dates
- Publication Date
- 20260512
- Application Date
- 20260309
Claims (4)
- 1. The gene for detecting the eimeria of swine is characterized in that the gene for detecting is a cox 1 gene, and the conservative sequence of the cox 1 gene is as follows: AGCTAATTGGTACCTTCCATTCTTACTGGTGGATTATTAATGCTAGTATTAGACTTACATCTAAATACTCAATTCTACGATGCATCATTTAATGGTGATCCAGTTCTATACCAACAA; the primer group of the cox 1 gene is as follows: upstream primer Cox-F GCTTTCGGTGTTATTTCTCA The downstream primer Cox-R TGTGCCCAAACTAATGAACC.
- 2. The kit for fluorescence quantitative PCR detection of the eimeria of swine is characterized by comprising an upstream primer Cox-F and a downstream primer Cox-R of a Cox 1 gene and SYAB Green fluorescence quantitative PCR detection reagents.
- 3. The method for preparing the pig eimeria fluorescent quantitative PCR detection kit according to claim 2, comprising the following steps: 1) Extracting a pig manure sample genome; 2) Performing fluorescent quantitative PCR detection on the genome in the step 1) by using SYAB Green fluorescent quantitative PCR detection reagents and primer groups; 3) Optimizing SYAB Green fluorescent quantitative PCR reaction conditions, and confirming annealing temperature and primer concentration; 4) Obtaining amplification curves and Ct values of the step 2) and the step 3); 5) Judging whether Eimeria coccidiosis is contained or not by Ct value When the Ct value of the sample to be detected is less than 35, the sample detection result is positive, the sample contains Eimeria coccidium, when the Ct value is more than or equal to 35, the sample detection result is negative, the sample does not contain Eimeria coccidium; 6) Judging infection intensity of Eimeria by Ct value Constructing an Eimeria oocyst DNA quantitative standard curve by using a SYBR GREEN QPCR method to obtain a quantitative relation model of Eimeria oocyst concentration (x) and Ct value, wherein Ct= -3.2047 x+ 35.011, and further obtaining the infection strength OPG= (35.011-Ct)/3.2047 .
- 4. The method for preparing the kit for fluorescence quantitative PCR detection of Eimeria in swine according to claim 3, wherein the annealing temperature in the fluorescent quantitative PCR reaction conditions of step 3) SYAB Green is 57.6 ℃ and the primer concentration of the cox 1 gene is 0.4 mu mol/L.
Description
Detection gene of eimeria coccidium of pig and fluorescent quantitative PCR detection kit and preparation method thereof Technical Field The invention relates to the technical field of biology, in particular to a detection gene of eimeria coccidium in pigs, a fluorescent quantitative PCR detection kit and a preparation method thereof. Background Eimeria infection is one of the common intestinal protozoal diseases in the pig industry, and can cause diarrhea, reduced growth performance and economic losses of different degrees for piglets. In China, the total infection of the pig Eimeria is common, and although some medicines for treating the Eimeria infection exist, the occurrence of the drug resistance is inevitable and worry is worried. The total infection rate of the pig coccidiosis in China is reported to be about 21.9%, which is a serious problem puzzled in many pig farms in China. At present, laboratory diagnosis of the coccidiosis in pigs is still based on microscopic examination and morphological identification of fecal oocyst floatation. However, in the non-sporulation state, the morphological distinction between different Eimeria coccidia and cyst and other spore coccidia is difficult, and is easily influenced by experience of inspection personnel, mixed infection and other factors, so that accurate identification and quantitative evaluation of the Eimeria coccidia of pigs are restricted. Molecular biological detection techniques based on nucleic acid amplification, such as conventional PCR, can only perform qualitative or semi-quantitative detection, and cannot accurately determine the infection intensity of Eimeria. Although the identification technology provides a higher specific basis for the detection of the pig coccidium, the identification technology mainly comprises qualitative or multi-step identification, and the problems of relatively complex operation flow, insufficient suitability for the fecal-like substrate inhibitor, lack of a uniform quantitative interpretation system and the like can still be faced in the conventional monitoring of a large-scale pig farm. Patent number 2013103827488 discloses a primer and a detection kit for detecting seven types of chicken eimeria, and discloses a primer and a detection kit for detecting seven types of chicken eimeria. The primer is designed according to specific sequences of IGS and ITS of Eimeria tenella, eimeria necatrix, eimeria maxima, eimeria acervulina, eimeria mitis, eimeria praecox and 7 Eimeria brunetti. The 7 pairs of primers are used for preparing the fluorescent quantitative PCR kit, so that the 7 chicken Eimeria can be accurately, objectively and quantitatively detected, and the specificity and the sensitivity of the detection kit are very high. Although SYAB Green fluorescence detection is mentioned, the detection targets used are different and cannot be applied to detect eimeria suis. Patent number 202410613484.0 discloses a double PCR primer group, kit and method for detecting pig intestinal parasitic protozoa. The invention is used for detecting the coccidium such as the bursa of swine and the Eimeria coccidium, and establishes a double PCR method for detecting the coccidium such as the bursa of swine and the Eimeria coccidium based on the primer group, the mixed infection and single infection condition of the coccidium such as the bursa of swine and the Eimeria coccidium in the sample to be detected can be determined by one double PCR reaction, compared with the common single PCR method, the method is quicker and more sensitive, has lower cost and simple operation compared with the real-time fluorescence quantitative PCR method, but has the problems that the method can only carry out qualitative detection on the infection of the pig coccidium and can not further judge the infection intensity. Further epidemiological monitoring is required for better control of swine coccidiosis. Therefore, it is of practical significance to develop an effective method for detecting infection by eimeria coccidiosis in pigs to prevent and control the spread of eimeria coccidiosis in pigs and to reduce economic losses. Disclosure of Invention In view of the above, the invention provides a detection gene of Eimeria in pigs, a fluorescent quantitative PCR detection kit and a preparation method thereof, and the kit has the characteristics of high sensitivity, strong specificity and good repeatability. The invention adopts the following technical scheme that the detection gene of the eimeria coccidium of pigs is characterized in that the detection gene is a cox 1 gene, and the conservative sequence of the cox 1 gene is as follows: AGCTAATTGGTACCTTCCATTCTTACTGGTGGATTATTAATGCTAGTATTAGACTTACATCTAAATACTCAATTCTACGATGCATCATTTAATGGTGATCCAGTTCTATACCAACAA; the primer group of the cox 1 gene is as follows: upstream primer Cox-F GCTTTCGGTGTTATTTCTCA The downstream primer Cox-R TGTGCCCAAACTAATGAACC. The kit for fluorescence quantitative PCR detection of the eimeri