Search

CN-122012774-A - Molecular marker related to oil content and protein content of soybean and application thereof

CN122012774ACN 122012774 ACN122012774 ACN 122012774ACN-122012774-A

Abstract

The invention relates to the technical field of plant breeding, in particular to a molecular marker related to oil content and protein content of soybeans and application thereof. The molecular marker is constructed based on SNP locus, and based on genome version number Wm82.a2.v1, the SNP locus is positioned at 8605814 th site of soybean chromosome 8, and polymorphism is A/G. The application comprises (1) predicting or detecting the oil content or the protein content of the soybean, (2) identifying or cultivating the soybean variety with high oil content or protein content, (3) molecular marker assisted breeding of the soybean, (4) soybean variety improvement related to the oil content or the protein content, and (5) soybean germplasm resource improvement. The molecular marker related to the soybean oil content and the protein content is obtained through research and screening, and the molecular marker can be applied to cultivation of soybean varieties with high oil content and high protein content, and has important value in the field of soybean breeding.

Inventors

  • FENG XIANZHONG
  • GAO JINSHAN
  • YAN ZHE
  • DU JIALIN
  • WANG DONGMEI
  • ZHANG YAOHUA
  • LI YONGLIANG
  • DU YEYAO
  • BU MORAN
  • WANG SHOUDONG

Assignees

  • 中国科学院东北地理与农业生态研究所
  • 中国农业科学院作物科学研究所

Dates

Publication Date
20260512
Application Date
20260129

Claims (10)

  1. 1. A SNP locus, characterized in that it is based on genomic version number wm82.a2.v1, said SNP locus being located at chromosome 8605814 of soybean, polymorphism a/G.
  2. 2. A molecular marker, characterized in that the molecular marker comprises a nucleic acid with a nucleotide sequence shown as SEQ ID NO.1, wherein the 27 th position of the molecular marker has polymorphism A/G.
  3. 3. A KASP primer combination, wherein the primer pair comprises: F1:5’-GCAAAATGTTATTGAAGTTGTTAATGT-3’; F2:5’-GCAAAATGTTATTGAAGTTGTTAATGC-3’; R:5’-TGAAGTACATATGGCGCCCATCCTAA-3’。
  4. 4. a kit comprising the molecular marker of claim 1 or 2, or the KASP primer combination of claim 3 or 4.
  5. 5. Use of the SNP locus of claim 1, or the molecular marker of claim 2 as a target in any of the following: (1) Predicting or detecting the oil content or protein content of the soybeans; (2) Identifying or breeding soybean varieties with high oil content or protein content; (3) Molecular marker assisted breeding of soybean; (4) Soybean variety improvement associated with oil content or protein content; (5) The germplasm resource of soybean is improved.
  6. 6. Use of the KASP primer combination of claim 3, or the kit of claim 4, in any of the following: (1) Predicting or detecting the oil content or protein content of the soybeans, or preparing a reagent for predicting or detecting the oil content or protein content of the soybeans; (2) Identifying or incubating the oil content or protein content of the soybeans, or preparing an agent for identifying or incubating the oil content or protein content of the soybeans; (3) Molecular marker assisted breeding of soybean; (4) Soybean variety improvement associated with oil content or protein content; (5) The germplasm resource of soybean is improved.
  7. 7. A method for detecting oil content or protein content of soybeans, comprising: Detecting the polymorphism of the molecular marker in claim 1 or 2 on a soybean sample to be detected, and judging the oil content or the protein content of the soybean to be detected according to the genotype detection result.
  8. 8. The method of claim 7, wherein the method of detecting comprises: One or more of gene sequencing, molecular probes, liquid phase capture, or mass spectrometry.
  9. 9. The method according to claim 7 or 8, wherein the determining the oil content or protein content of the soybean to be tested according to the genotype test result comprises: Peanut with genotype of GG has higher oil content and protein content than peanut with genotype of AA.
  10. 10. A method for breeding high oil or protein soybean comprising: in the soybean breeding process, the offspring select the soybean with the genotype GG of the molecular marker of claim 1 or 2.

Description

Molecular marker related to oil content and protein content of soybean and application thereof Technical Field The invention relates to the technical field of plant breeding, in particular to a molecular marker related to oil content and protein content of soybeans and application thereof. Background Soybeans are important oil crop and vegetable protein sources, whose Seed Oil Content (SOC) and protein content (SPC) are the core agronomic traits that determine their economic value. In the existing breeding practice, the oil content and the protein content of the soybean often show obvious negative correlation, and the antagonistic relation between the characteristics enables the content of the soybean and the protein to be synergistically improved to have extremely high technical challenges, so that the comprehensive economic benefit of high-quality soybean varieties is limited. Traditional breeding screens rely primarily on phenotypic identification after plant maturation. The method has the advantages of long selection period, high labor cost, easy interference of external environment factors such as illumination, soil, climate and the like, hysteresis and uncertainty of the phenotype identification result, and serious restriction on improvement of breeding efficiency. With the development of genomics technology, molecular marker assisted breeding (MAS) technology has become an important means for achieving accurate screening of early generations. Among them, competitive allele-specific PCR (KASP) technology shows good application prospects in the field of crop genetic improvement by virtue of its technical advantages of high throughput, low cost, closed tube operation, no need of electrophoresis detection, and the like. Through developing molecular markers closely linked with oil content and protein content, the KASP technology is utilized to carry out genotype identification in a seedling stage and even a seed stage, and the method has important significance for realizing rapid and accurate breeding of high-quality soybean varieties. Disclosure of Invention In order to solve the technical problems in the prior art, the invention provides a molecular marker related to oil content and protein content of soybeans and application thereof. In a first aspect, the invention provides a SNP site, based on genomic version number Wm82.a2.v1, which is located at position 8605814 of chromosome 8 of soybean, and the polymorphism is A/G. In a second aspect, the present invention provides a molecular marker comprising a nucleic acid having a nucleotide sequence as set forth in SEQ ID NO.1, wherein the polymorphism at position 27 is A/G. The nucleotide sequence shown as SEQ ID NO.1 (the sequence is the reverse sequence, thus T is the present place, and the complementary nucleotide is A): GCAAAATGTTATTGAAGTTGTTAATGTTAATTTTTTGCTAGCGGGAAAATTGAATTCACCACTTTTTTCTTCCTTTCTTCTCTTTTTATCACCAAAACAACCTTATAACTCCTAAAACCATTTTCGTGCCTAAAATTTGTATATTAATAATTTAATACAACATTTGAGTTCTCATCTTTTTTTCTTGTTTCCCTTAGGATGGGCGCCATATGTACTTCA. Further, the aforementioned SNP site and the aforementioned molecular marker, G represents a high oil content and a protein content, and A represents a low high oil content and a protein content. In a third aspect, the present invention provides a primer pair for amplifying the aforementioned molecular marker. The method for designing the primer pair according to the present invention may be a conventional method according to the present invention, and a skilled person may design primer pairs (including primer pairs or KASP primer combinations) having different lengths according to existing primer design rules and primer design software (e.g., primer) for amplifying the aforementioned molecular markers. In a fourth aspect, the invention provides a KASP primer combination, the primer pair comprising the nucleotide sequence as set forth in SEQ ID NO.2-SEQ ID NO. 4. (1) F1 (SEQ ID NO.2, A allele primer): 5'-GCAAAATGTTATTGAAGTTGTTAATGT-3' (2) F2 (SEQ ID NO.3, G allele primer): 5'-GCAAAATGTTATTGAAGTTGTTAATGC-3'. (3) R (SEQ ID NO.4, universal downstream primer): 5'-TGAAGTACATATGGCGCCCATCCTAA-3'. The primers of SEQ ID No.2 and SEQ ID No.3 above include a fluorescent tag sequence at the 5 'or 3' end, which may be one or more of FAM, TET, HEX, ROX, cy, cy5, alexa Fluor, SYBR Green, DAPI, FITC or Texas Red. For example GAAGGTGACCAAGTTCATGCT (FAM fluorescent tag sequence), GAAGGTCGGAGTCAACGGATT (HEX fluorescent tag sequence). In a fifth aspect, the invention provides a kit comprising the aforementioned molecular markers, or the aforementioned KASP primer combinations. Further, the kit also comprises one or more of KASP MASTER Mix, A allele homozygous positive control DNA, G allele homozygous positive control DNA, negative control and instructions. The kit can be directly used for large-scale laboratory detection, the operation flow is simple and easy to understand, the detection result is accurate and reliable, and the kit can be