Search

CN-122012775-A - Alfalfa salt tolerance and biomass related molecular marking method and breeding application

CN122012775ACN 122012775 ACN122012775 ACN 122012775ACN-122012775-A

Abstract

The invention belongs to the technical field of plant molecular marker breeding, and particularly relates to a salt tolerance and biomass related molecular marker method for alfalfa and application thereof in breeding, wherein the method comprises a KASP molecular marker KFZBJ _2 related to the number of alfalfa branches, the molecular marker corresponds to a SNP locus Chr2_5456171 on a chromosome of alfalfa Chr2, and a primer group comprises a primer X, a primer Y and a universal primer, wherein the sequences of the primer X, the primer Y, the primer GAAGGTCGGAGTCAACGGATTCAAGTCTAGACTGCATGGTCAAGA and the universal primer CTAAATTATCTGATCAAGATCTGACGACTT are respectively primer X and GAAGGTGACCAAGTTCATGCTAAGTCTAGACTGCATGGTCAAGG.

Inventors

  • LIU LINGTONG
  • Fan Jinwan
  • CHEN BINGTANG
  • WANG TAI
  • DENG ZHUYUN

Assignees

  • 中国科学院植物研究所

Dates

Publication Date
20260512
Application Date
20260130

Claims (7)

  1. 1. The alfalfa salt tolerance and biomass related molecular marking method is characterized by comprising a KASP molecular mark KFZBJ _2 related to alfalfa branch number; The molecular marker corresponds to SNP locus Chr2_5456171 on alfalfa Chr2 chromosome, and the primer group comprises a primer X, a primer Y and a universal primer, and the sequences are respectively as follows: primer X GAAGGTGACCAAGTTCATGCTAAGTCTAGACTGCATGGTCAAGG; Primer Y GAAGGTCGGAGTCAACGGATTCAAGTCTAGACTGCATGGTCAAGA; and a universal primer CTAAATTATCTGATCAAGATCTGACGACTT.
  2. 2. The method for marking salt tolerance and biomass related molecules of alfalfa of claim 1, comprising a KASP molecular marker KFZBJ _3 related to alfalfa plant height; the molecular marker corresponds to SNP locus Chr1_26013590 on alfalfa Chr1 chromosome, and the primer group comprises a primer X, a primer Y and a universal primer, and the sequences are respectively as follows: primer X GAAGGTGACCAAGTTCATGCTATAGTCCGGGGCAGACTCAAAT; primer Y GAAGGTCGGAGTCAACGGATTAGTCCGGGGCAGACTCAAAC; And a universal primer GGTAATGAGTGTAACAAAGCCATTGACTT.
  3. 3. The method for preparing the alfalfa salt tolerance and biomass related molecular marker according to claim 1, which is characterized by comprising a KASP molecular marker KFZBJ _24 related to alfalfa salt tolerance, wherein the molecular marker corresponds to an SNP locus Chr3_73727583 on a alfalfa Chr3 chromosome, and the primer set comprises a primer X, a primer Y and a universal primer, and the sequences are respectively: primer X GAAGGTGACCAAGTTCATGCTCAGAKYGGCGTTSGTAAATTTA; Primer Y GAAGGTCGGAGTCAACGGATTAGAKYGGCGTTSGTAAATTTG; and a universal primer GTCTCCRCTTCTCCTTTCAAG.
  4. 4. The method for preparing the alfalfa salt tolerance and biomass related molecular marker according to claim 1, which is characterized by comprising a KASP molecular marker KFZBJ _25 related to alfalfa salt tolerance, wherein the molecular marker corresponds to an SNP locus Chr2_27368015 on a alfalfa Chr2 chromosome, and the primer group comprises a primer X, a primer Y and a universal primer, and the sequences are respectively: Primer X GAAGGTGACCAAGTTCATGCTCGCTTCTTAGCTTTGAAACTTT; primer Y GAAGGTCGGAGTCAACGGATTCGCTTCTTAGCTTTGAAACTTG; And a universal primer GCTAAAGATTGATTCAAAACTGACC.
  5. 5. The application of the alfalfa salt tolerance and biomass related molecular marking method based on the alfalfa salt tolerance and biomass related molecular marking method according to any one of claims 1-4 is characterized in that the application comprises parent selection and offspring screening in high-yield alfalfa breeding or salt tolerance breeding.
  6. 6. The alfalfa salt tolerance and biomass related molecular marker breeding application of claim 1, wherein the high-yield breeding is characterized in that a multiple linear regression model Y= -139.6855+1.9929×branch number+ 2.5566 ×plant height is adopted to predict alfalfa single plant dry weight.
  7. 7. The alfalfa salt tolerance and biomass-related molecular marker breeding application of claim 5, wherein KFZBJ _24 is marked to screen NYL2 locus AG type salt tolerance allele plants, KFZBJ _25 is marked to screen NYL1 locus GG type salt tolerance allele plants.

Description

Alfalfa salt tolerance and biomass related molecular marking method and breeding application Technical Field The invention belongs to the technical field of related molecular marking methods, and particularly relates to a alfalfa salt tolerance and biomass related molecular marking method and a breeding application. Background Alfalfa, which is a quality leguminous grass, has biomass, she Jingbi, which is a core agronomic trait that determines yield and feeder quality, and has an irreplaceable position in animal husbandry production. The traditional breeding mode mainly depends on field phenotype observation and screening, has long period, is easily interfered by environmental factors such as climate, soil and the like, causes insufficient selection accuracy, is difficult to quickly polymerize excellent genes, and cannot meet urgent requirements of large-scale production on high-yield and high-quality varieties. Meanwhile, compared with the genetic background of the biomass related characters, the leaf and stem are complex, the conventional breeding is difficult to precisely target and regulate key genetic loci, and the efficiency and the progress of variety improvement are severely restricted. Soil salinization has become an important ecological problem that restricts the sustainable development of agriculture in the global scope, and obviously limits the planting range and the production potential of alfalfa. Along with the expansion of irrigation agriculture and the change of ecological environment, the saline-alkali soil area is continuously expanded, and the cultivation of alfalfa varieties with strong salt tolerance becomes a key for guaranteeing the stable development of pasture industry. Traditional salt tolerant breeding mainly relies on natural variation screening or crossbreeding, has the bottleneck that the cycle is long, the selection efficiency is low, the excellent properties such as salt tolerance and high yield are difficult to synergistically improve, and lacks early and quick screening means, so that salt tolerant gene individuals cannot be accurately identified in the early stage of breeding. Although the molecular marker assisted selection technology provides possibility for breaking through the traditional breeding limitation, the technology for supporting the breeding practice by a mature technical system is not formed at present aiming at the scarcity of salt tolerance, she Jingbi and biomass related high-efficiency specific molecular marker resources of alfalfa, and the development of a precise targeted molecular marker tool is needed. Disclosure of Invention The invention aims at solving the technical problems and provides a alfalfa salt tolerance and biomass related molecular marking method and breeding application. In view of this, the present invention provides a method for the salt tolerance and biomass related molecular marker of alfalfa, comprising the KASP molecular marker KFZBJ _2 related to the number of branches of alfalfa; The molecular marker corresponds to SNP locus Chr2_5456171 on alfalfa Chr2 chromosome, and the primer group comprises a primer X, a primer Y and a universal primer, and the sequences are respectively as follows: primer X GAAGGTGACCAAGTTCATGCTAAGTCTAGACTGCATGGTCAAGG; Primer Y GAAGGTCGGAGTCAACGGATTCAAGTCTAGACTGCATGGTCAAGA; and a universal primer CTAAATTATCTGATCAAGATCTGACGACTT. Preferably, the kit comprises a KASP molecular marker KFZBJ _3 related to alfalfa plant height; the molecular marker corresponds to SNP locus Chr1_26013590 on alfalfa Chr1 chromosome, and the primer group comprises a primer X, a primer Y and a universal primer, and the sequences are respectively as follows: primer X GAAGGTGACCAAGTTCATGCTATAGTCCGGGGCAGACTCAAAT; primer Y GAAGGTCGGAGTCAACGGATTAGTCCGGGGCAGACTCAAAC; And a universal primer GGTAATGAGTGTAACAAAGCCATTGACTT. Preferably, the kit comprises a KASP molecular marker KFZBJ _24 related to the plant height of alfalfa, wherein the molecular marker corresponds to an SNP locus Chr3_73727583 on a chromosome of alfalfa Chr3, and the primer set comprises a primer X, a primer Y and a universal primer, and the sequences are respectively as follows: primer X GAAGGTGACCAAGTTCATGCTCAGAKYGGCGTTSGTAAATTTA; Primer Y GAAGGTCGGAGTCAACGGATTAGAKYGGCGTTSGTAAATTTG; and a universal primer GTCTCCRCTTCTCCTTTCAAG. Preferably, the kit comprises a KASP molecular marker KFZBJ _25 related to salt tolerance of alfalfa, wherein the molecular marker corresponds to SNP locus Chr2_27368015 on a chromosome of the alfalfa Chr2, and the primer set comprises a primer X, a primer Y and a universal primer, and the sequences of the primer X, the primer Y and the universal primer are respectively as follows: Primer X GAAGGTGACCAAGTTCATGCTCGCTTCTTAGCTTTGAAACTTT; primer Y GAAGGTCGGAGTCAACGGATTCGCTTCTTAGCTTTGAAACTTG; And a universal primer GCTAAAGATTGATTCAAAACTGACC. The application of the alfalfa salt tolerance and biomass related molecular marking method comprises parent sele