Search

CN-122012776-A - Kasp marker PH2-10-Kasp-147 closely linked with corn plant height and application thereof

CN122012776ACN 122012776 ACN122012776 ACN 122012776ACN-122012776-A

Abstract

The invention relates to the technical field of plant molecular breeding, in particular to Kasp marker PH2-10-Kasp-147 closely linked with corn plant height and application thereof, which provides a high-efficiency corn plant height identification and dwarf screening technology, wherein Indel sites at 144727660 positions of 10 th chromosomes of corn are used, polymorphism is GCTGCTCATGAA/-, KASP primer groups are designed in a matched manner, an optimized 10 mu LPCR system and a three-stage reaction program are adopted, plant height characters are quantitatively judged through fluorescent signal relative values, the marker effect value E is less than or equal to 28 after two years of four verification of 465 corn inbred lines, and typing, plant height phenotype and Sanger sequencing fitness reach 100%. The invention has high standardization degree and high detection efficiency, can realize early screening of corn at seedling stage, remarkably improves the breeding efficiency of short-stalk, lodging-resistant and close-planting-resistant corn, and provides powerful technical support for guaranteeing grain safety.

Inventors

  • LU HONG
  • ZHU XIAOBO
  • DU GUOHUA
  • WANG PEIDONG

Assignees

  • 中国农业科学院深圳农业基因组研究所(岭南现代农业科学与技术广东省实验室深圳分中心)

Dates

Publication Date
20260512
Application Date
20260202

Claims (10)

  1. 1. The Kasp marker PH2-10-Kasp-147 closely linked with the corn plant height is characterized by comprising Indel sites closely linked with the corn plant height character and identifying the corn plant height character, kasp molecular marker primer groups identifying the Indel sites and a kit for detecting the corn plant height character; Indel locus for identifying the plant height character of the corn is positioned on chromosome 144727660 of 10 th corn, the polymorphism is GCTGCTCATGBB/-, the corn shows a low stalk character when the genotype is GCTGCTCATGAA: GCTGCTCATGAA, and the corn shows a high stalk character when the genotype is-: -or GCTGCTCATGAA: -.
  2. 2. The Kasp marker PH2-10-Kasp-147 closely linked to maize plant height of claim 1, wherein said Kasp molecular marker primer set comprises forward primer 1, forward primer 2 and reverse primer; the sequence of the forward primer 1 is GAAGGTGACCAAGTTCATGCTCGGCAACACCAGCAGCT; the sequence of the forward primer 2 is GAAGGTCGGAGTCAACGGATTCGGCAACACCAGCAGCA; The sequence of the reverse primer is CCCGACTGCCCACTGACG; Correlation between Kasp genotyping results based on the primer sets and corn plant height traits accords with the following judgment model: ; Wherein H is the corn plant height property judging result, F FAM is the reading value of the FAM fluorescent label sequence under the wavelength of 485nm of excitation light and 520nm of emission light, F HEX is the reading value of the HEX fluorescent label sequence under the wavelength of 528nm of excitation light and 560nm of emission light, and F ROX is the reading value of the reference dye.
  3. 3. The Kasp marker PH2-10-Kasp-147 closely linked to the corn plant height according to claim 2, wherein the forward primer 1 and the forward primer 2 are used at a concentration of 4-10 mu mol/L independently, the reverse primer is used at a concentration of 4-10 mu mol/L, the concentration range is determined based on verification of corn inbred line materials, when the concentration is lower than 4 mu mol/L, PCR amplified signal intensity is insufficient, genotype clustering is fuzzy, when the concentration is higher than 10 mu mol/L, nonspecific amplification is initiated, the typing accuracy is reduced to below 90%, the concentration is selected to be 6-8 mu mol/L, the fluorescent signal to noise ratio of Kasp gene typing in the concentration range is more than or equal to 3.5, the homozygous gene type clustering dispersion is less than or equal to 0.15, the heterozygous gene type clustering center deviation is less than or equal to 0.2, and the coincidence degree with the corn plant height phenotype is maintained at 100%.
  4. 4. The Kasp marker PH2-10-Kasp-147 closely linked to maize plant height of claim 3, wherein the volume ratio of forward primer 1, forward primer 2 and reverse primer is 2:2:5.
  5. 5. The Kasp marker PH2-10-Kasp-147 closely linked with the corn plant height according to claim 4, wherein the kit comprises a Kasp molecular marker primer group, a 2X ProbeMixA solution and ddH 2 O, the PCR amplification reaction system of the kit comprises 2 mu L of corn genome DNA, 0.14 mu L of primer group, 5 mu L, ddH 2 O2.86 mu L of 2X ProbeMixA solution and the concentration of the corn genome DNA is 50-100 ng/. Mu.L.
  6. 6. The Kasp marker PH2-10-Kasp-147 closely linked to maize plant height according to claim 1, wherein the PCR amplification reaction is performed by 10 cycles of 95℃pre-denaturation for 10min, 95℃denaturation for 20s,61℃annealing for 40s, 95℃denaturation for 20s,55℃annealing for 40s, 31 cycles, 25℃holding for 10min, and 4℃storage.
  7. 7. Use of the Kasp marker PH2-10-Kasp-147 in close linkage with maize plant height according to any one of claims 1-6, including use in maize breeding and in screening for dwarf maize; when the marker effect verification algorithm is applied to corn breeding, the association between Indel sites and corn plant height is verified by adopting the following marker effect verification algorithm: ; Wherein E is the plant height effect value of Indel locus, H BBi is the plant height value of ith homozygous BB genotype corn material, The average plant height value of the homozygous BB genotype corn material is n, the number of the homozygous BB genotype corn material is n, CV is the variation coefficient of the plant height data of all tested corn materials, and when E is less than or equal to-25, the Indel site is obviously related to the dwarf trait.
  8. 8. The use of Kasp marker PH2-10-Kasp-147 closely linked to maize plant height according to claim 7, wherein in said screening of dwarf maize the use comprises the steps of: (1) Extracting genome DNA of corn materials to be screened; (2) Performing PCR amplification on the genomic DNA by using the Kasp molecular marker primer set according to claim 2 to obtain an amplification product; (3) Carrying out Kasp genotyping detection on the amplified product, and determining the plant height character of the corn material according to the judging model of claim 2; (4) And (5) screening the corn material with the short stalk according to the screening judgment result, and finishing the screening of the short stalk corn.
  9. 9. The use of Kasp marker PH2-10-Kasp-147 closely linked to maize plant height according to claim 1 wherein the selection efficiency is assessed during the breeding of maize using the following genetic gain estimation formula: ; Wherein G is genetic gain, h 2 is generalized genetic rate of corn plant height character, i is selection strength, sigma p is phenotype standard deviation of corn plant height character, and the generalized genetic rate of corn plant height character is calculated by the following formula: ; Where V G is the genetic variance and V E is the environmental variance.
  10. 10. The use of Kasp marker PH2-10-Kasp-147 closely linked to maize plant height according to claim 1, wherein, when used in screening short maize, the fitness of the Kasp genotyping test result to maize plant height trait is verified by the following formula: ; Wherein C is the fitness, N Consistency of is the corn material quantity with Kasp genotyping detection result consistent with the actual plant height character, N Total (S) is the total quantity of tested corn materials, and when C is more than or equal to 98%, the primer group is judged to be applicable to short corn screening.

Description

Kasp marker PH2-10-Kasp-147 closely linked with corn plant height and application thereof Technical Field The invention relates to the technical field of plant molecular breeding, in particular to Kasp marker PH2-10-Kasp-147 closely linked with corn plant height and application thereof. Background Corn is used as the grain crop with the widest sowing area and the highest total yield in China, and occupies about 40% of the total yield of grains in China, thus occupying an important strategic position in guaranteeing the national grain safety. However, the corn yield per unit of China is only about 60% of the United states, the fertilizer consumption per unit area is three times of that of the United states, and the difference between the yield and the resource utilization efficiency is remarkable. The plant height is used as the agronomic character of the corn core, the lodging resistance and the close planting resistance are directly determined, the cultivation of new varieties of short-stalk lodging-resistant close planting-resistant corn is a key break for improving unit yield and guaranteeing grain safety, and the excavation of molecular markers closely linked with the corn plant height and the establishment of a high-efficiency detection system are core technical supports for accelerating the breeding process. With the development of molecular biology technology, single Nucleotide Polymorphisms (SNPs) and insertion/deletion markers (indels) have become common molecular marker types in crop genetic breeding, and the characteristics of wide distribution and genetic stability make them suitable for trait association analysis. Competitive allele-specific PCR (KASP) technology has been widely used in crop molecular marker-assisted breeding by virtue of the advantages of high throughput, high precision and low cost, and has become a core platform for SNP and Indel marker typing. In the prior art, a comparison document CN109337998A discloses a SNP marker related to the plant height of corn and a corresponding KASP primer, and the technology realizes auxiliary selection of the plant height character of corn by screening SNP locus design primers on specific chromosomes of corn. However, the practice proves that the comparison document has obvious defects: firstly, the association strength of the SNP markers disclosed by the SNP markers and the corn plant height is limited, the marker effect value is low, and the stability in multiple environments and large groups is insufficient and the typing result and the phenotype fitness are easily reduced due to the influence of geographical climate conditions through single environment or verification of a small amount of materials; Secondly, the optimal use concentration and volume ratio of the primer are not defined in the technology, and nonspecific amplification or primer dimer is easy to occur in the PCR amplification process, so that the typing accuracy is affected; thirdly, the lack of quantitative plant height character judgment standards is only judged qualitatively through fluorescent signal clustering trend, subjectivity is strong, and repeatability of different laboratory operations is poor; fourth, a systematic algorithm for marking effect verification and genetic gain estimation is not provided, and the breeding application value is difficult to evaluate accurately. Disclosure of Invention The invention aims to provide Kasp marks PH2-10-Kasp-147 closely linked with corn plant height and application thereof, so as to solve the problems of weak mark relevance, non-optimized detection system, poor result repeatability and inaccurate application value evaluation in the background art. In order to achieve the aim, the invention provides a Kasp marker PH2-10-Kasp-147 closely linked with the corn plant height, which comprises Indel sites closely linked with the corn plant height character and identifying the corn plant height character, kasp molecular marker primer groups identifying the Indel sites and a kit for detecting the corn plant height character; Indel locus for identifying the plant height character of the corn is positioned on chromosome 144727660 of 10 th corn, the polymorphism is GCTGCTCATGBB/-, the corn shows a low stalk character when the genotype is GCTGCTCATGAA: GCTGCTCATGAA, and the corn shows a high stalk character when the genotype is-: -or GCTGCTCATGAA: -. Preferably, the Kasp molecular marker primer set comprises a forward primer 1, a forward primer 2 and a reverse primer; the sequence of the forward primer 1 is GAAGGTGACCAAGTTCATGCTCGGCAACACCAGCAGCT; the sequence of the forward primer 2 is GAAGGTCGGAGTCAACGGATTCGGCAACACCAGCAGCA; the sequence of the reverse primer is CCCGACTGCCCACTGACG, and the correlation between the Kasp genotyping result based on the primer group and the corn plant height character accords with the following judging model: ; Wherein H is the corn plant height property judging result, F FAM is the reading value of the FAM fl