CN-122012791-A - Molecular marker primer closely linked with brown planthopper resistant major gene Bph48 of rice, and marking method and application thereof
Abstract
The invention provides a molecular marker primer closely linked with a brown planthopper resistant major gene Bph48 of rice, and a marking method and application thereof. The invention hybridizes the rice insect-resistant variety 75-9-3 (C268 for short) with the genotype of each F2 single plant obtained by the Yangli No. 9 (9311 for short), and simultaneously combines the brown planthopper resistance grade of the F3 family to carry out genetic linkage analysis, identifies the main resistance gene Bph48 carried by the insect-resistant variety C268, reduces the Bph48 positioning area to a 370kb fragment defined by two side markers 1M30.093 and 1M30.471, and is tightly linked with a molecular marker 1M30.471. The molecular marker 1M30.471 can effectively detect whether the pest-resistant variety C268 and the derivative variety (line) thereof contain the main effective resistance gene locus, greatly improve the selection efficiency of brown planthopper resistance characters and obtain the brown planthopper resistant rice variety (line) containing Bph 48.
Inventors
- QIU YONGFU
- CHENG HAIYAN
- WU YUNING
- QIN QINGYUAN
Assignees
- 广西大学
Dates
- Publication Date
- 20260512
- Application Date
- 20260313
Claims (4)
- 1. A molecular marker primer closely linked with a brown planthopper resistant major gene Bph48 of rice, a marking method and application thereof, wherein the molecular marker primer is obtained by PCR amplification of the following primer pairs: Labeled primer 1M30.471 Left primer sequence CAATACCACACATCTGGCCC Right primer sequence CAGCAACTGTCAAAACTAGAGAG.
- 2. The molecular marker primer closely linked with the brown planthopper major gene Bph48 of the rice as well as a marking method and application thereof, which are characterized in that the molecular marker is applied to breeding brown planthopper resistant rice varieties.
- 3. As described in claim 1, the primers can amplify genomic DNA of rice leaves to be detected, and detect amplified products, if the primers 1M30.471 can amplify fragments with corresponding sizes of 100bp in resistant varieties, the primers mark that the brown planthopper resistant major gene Bph48 exists in the rice to be detected.
- 4. A method for screening brown planthopper resistant rice, which uses the primer pair of claim 1 to amplify genome DNA of rice leaves to be detected, if a 100bp fragment is amplified by using a primer 1M30.471, the rice to be detected is marked as a resistant rice material carrying a brown planthopper resistant major gene Bph 48.
Description
Molecular marker primer closely linked with brown planthopper resistant major gene Bph48 of rice, and marking method and application thereof Technical Field The invention belongs to the field of molecular genetics, relates to a molecular marker primer closely linked with a brown planthopper resistant major gene Bph48 of rice, a marking method and application thereof, and also relates to application of the molecular marker in breeding brown planthopper resistant varieties of rice. Background The rice planthoppers are one of the most serious field insect pests in a rice producing area, and mainly comprise brown planthoppers, laodelphax striatellus, sogatella furcifera and the like, wherein the brown planthoppers are the most serious in hazard. Brown planthoppers are a single feeding pest, and are usually only spawned, propagated and eaten on rice and ordinary wild rice. The imago and nymphs of the rice stem base are pricked with a needle to suck the phloem juice of the plant, so that yellow leaves or dead rice plants are caused, brown planthoppers are used as insect vectors of rice virus diseases, the rice is possibly infected, and finally, the yield is reduced or the plant is prevented from being killed. Since the damage of brown planthoppers occurs mostly in the mature rice filling period, the use of a large amount of pesticides at this time is a serious problem of environmental and rice pollution. The cultivation of insect-resistant rice variety by using brown planthopper-resistant gene is the most economical and effective method in the comprehensive control of brown planthopper. Since the 70 s of the last century, nearly 50 brown planthopper resistant major genes have been reported, of which 17 genes have been cloned, including Bph1, bph2, bph3, bph6, bph9, bph14, etc., and some brown planthopper resistant major genes have been improved in variety genetic improvement in domestic and international brown planthopper resistant rice breeding. However, due to the emergence of brown planthopper new biotypes, brown planthopper resistant varieties gradually lose resistance or are at risk of losing resistance. Individual resistance genes gradually lose resistance under long-term planting, for example, insect-resistant varieties with Bph1, lose resistance soon after years of popularization and planting, and varieties carrying both Bph1 and Bph2 show stronger and more durable resistance. Thus, there is an urgent need for insect-resistant varieties carrying new and multiple resistance genes in rice production. It is often difficult to efficiently introduce and aggregate different insect-resistant genes using conventional breeding means. The invention can purposefully conduct the introduction and polymerization of the insect-resistant gene on the basis of finding the molecular marker closely linked or co-separated with the insect-resistant gene by means of the molecular marker assisted selection technology, breeds the durable resistant variety, delays the degeneration period of the insect-resistant variety and prevents the occurrence of new biological type brown planthoppers. Disclosure of Invention The invention aims to provide a molecular marker primer closely linked with a brown planthopper resistant major gene Bph48 of rice, a marking method and application thereof, and the molecular marker closely linked with the brown planthopper resistant major gene is detected to predict the resistance of rice plants to brown planthoppers and accelerate the breeding progress of the brown planthopper resistant rice varieties. The molecular marker of the brown planthopper resistant major gene Bph48 of the rice is obtained by PCR amplification of the following primer pairs: Labeled primer 1M30.471 Left primer sequence CAATACCACACATCTGGCCC Right primer sequence CAGCAACTGTCAAAACTAGAGAG. The invention also provides a molecular marking method of the rice brown planthopper resistant major gene Bph48, which is to amplify genome DNA of rice leaves to be detected by using the primer pair, and if a fragment with the size of 100bp in a resistant variety can be amplified by using the primer 1M30.471, the rice to be detected is marked to contain the brown planthopper resistant major gene Bph48. The procedure for screening the labeled primers was as follows: (1) Rice variety C268 is a Guangxi local farmhouse species and has high brown planthopper resistance. Based on the localization process of the resistance gene, the invention develops a molecular marker closely linked with the resistance gene. In one aspect, a number of molecular markers are selected according to a relatively uniform genetic distance based on existing InDel molecular markers. On the other hand, based on the targeting segment of the resistance gene, inDel markers were designed for fine targeting in segments having differences between the two, with reference to the genomic sequences corresponding to Nippon and 9311 rice varieties (lines). (2) The F 2 segregating population o