CN-122012792-A - Kasp mark EL-5-KASP-387 closely linked with corn ear length and application thereof
Abstract
The invention relates to the technical field of plant molecular breeding, in particular to Kasp marked EL-5-KASP-387 closely linked with the length of corn ears and application thereof, wherein an Indel functional site corresponding to Kasp marked is positioned at 184049387 position of a No. 5 chromosome of corn, polymorphism is-/TGA, and a matched specific primer group consists of two forward primers and one reverse primer. The invention locates the major site of the spike length through whole genome association analysis, the developed KASP marker can accurately distinguish three genotypes, the spike length character identification can be completed in the seedling stage, and the weighted matching degree of the genotypes and the phenotypes is 99.2%. The method does not need gel electrophoresis, has the advantages of high throughput and high precision, can greatly shorten the breeding period of long corn with long spike, improves the breeding selection accuracy, and provides high-efficiency technical support for directional breeding of corn high-yield molecules.
Inventors
- LU HONG
- DU GUOHUA
- WANG PEIDONG
- ZHU ZHENGHANG
- YIN YILIANG
Assignees
- 中国农业科学院深圳农业基因组研究所(岭南现代农业科学与技术广东省实验室深圳分中心)
Dates
- Publication Date
- 20260512
- Application Date
- 20260323
Claims (10)
- 1. The Kasp-KASP-387 is closely linked with the corn ear length and is characterized by comprising a specific Indel site and a corresponding KASP molecular marker primer group, wherein the Indel site is positioned at 184049387 of a5 th chromosome of corn, and the polymorphism is-/TGA; The KASP is marked as EL-5-KASP-387, and the corresponding primer group comprises a forward primer 1, a forward primer 2 and a reverse primer; The sequence of the forward primer 1 is GAAGGTGACCAAGTTCATGCTAAACGTCGAAGGACCATCAA, the sequence of the forward primer 2 is GAAGGTCGGAGTCAACGGATTAAACGTCGAAGGACCATCAT, and the sequence of the reverse primer is TCTTGTGCCATCTCACATGCT; The linkage tightness degree of the KASP marker and the corn cob length major QTL is calculated by the following formula, and the spike length character genetic effect corresponding to the marker is quantified by the following formula: ; ; ; ; ; ; in the formula, D' is the linkage disequilibrium coefficient of the marker and the spike length major QTL, D is the linkage disequilibrium between loci, For the frequency of occurrence of TGA alleles in the natural population, To frequency of occurrence of the long ear length phenotype in the natural population, For haplotype frequencies where TGA alleles coexist with long spike length phenotypes, For the theoretical maximum of linkage disequilibrium, The value range is 0 to 1, Judging that the marker and the spike length character are in close linkage relation when the ratio is more than or equal to 0.9, wherein a is the additive effect value of the spike length character, d is the dominant effect value of the spike length character, For the degree of dominance, The average value of the ear length phenotype of the TGA homozygous genotype group, Is- & gtthe average value of the ear length phenotype of the homozygous genotype group, The average value of the spike length phenotype of the TGA-heterozygous genotype population is provided with a genetic effect quantification basis for molecular marker assisted selection through the gene action mode of the dominant degree judgment site.
- 2. The Kasp-KASP-387 labeled with the key closely linked to the ear length according to claim 1, wherein the forward primer 1 and the forward primer 2 are used at a concentration of 4 to 10. Mu. Mol/L independently, the reverse primer is used at a concentration of 4 to 10. Mu. Mol/L, the concentration ranges are adapted to PCR reaction systems of different specifications of 10. Mu.L, 20. Mu.L and 50. Mu.L, and when the reaction system is expanded or contracted multiple, the primer concentration is adjusted synchronously in proportion to ensure that the molar ratio of the primer to the template DNA is maintained between 1:5 and 1:10.
- 3. The Kasp-KASP-387 labeled with the close linkage to the corn ear length according to claim 1, wherein the volume ratio of the forward primer 1, the forward primer 2 and the reverse primer in the primer set is 2:2:5, the volume ratio is determined based on the difference of the Tm values of the primers and the optimization of the binding efficiency, the Tm values of the forward primer 1 and the forward primer 2 are all 60 ℃ to 62 ℃, the Tm value of the reverse primer is 58 ℃ to 60 ℃, the volume ratio can ensure the balance of competitive binding of the three primers in the PCR reaction, and when preparing the primer mix, 6 mu L of the forward primer 1, 6 mu L of the forward primer 2 and 15 mu L of the reverse primer are added with 23 mu LddH O and uniformly mixed to form 50 mu L of the primer mix for standby.
- 4. The Kasp-KASP-387 marker closely linked to ear length of corn according to claim 1, wherein the genetic contribution of the KASP marker to ear length trait is verified by a multi-loop mixed linear model corrected phenotypic variation interpretation rate formula as follows: ; ; In the formula, PVE is the phenotype variation interpretation rate of the marker on the spike length character, vp is the total surface type variance of the spike length character, vg is the genetic variance corresponding to the marker, vs is the variance component caused by the group structure, vk is the variance component caused by the relativity among materials, ve is the environmental error variance, vg+e is the residual variance sum not including the marker effect, the formula corrects the interference of the group structure and the relativity on the phenotype variation, and accurately quantifies the true genetic contribution of the marker on the spike length character, wherein the PVE is not lower than 10%.
- 5. The Kasp-KASP-387 labeled with the close linkage to the ear length according to claim 1, wherein the forward primer 1 and the forward primer 2 have single base difference between the 3' terminal base, and the two allelic variants of the Indel site are specifically matched, the GC content of 15 continuous bases from the 3' end to the 5' end of the primer is 40% to 60%, and the primer dimer and hairpin structure are not included, so that the specificity and typing accuracy of the PCR amplification are ensured.
- 6. A method for screening long-spike corn using Kasp-KASP-387 labeled EL-5 according to any one of claims 1 to 5, comprising the steps of: step 1, extracting genome DNA of a corn sample; Step 2, taking the genome DNA as a template, and carrying out PCR amplification by adopting the primer group to obtain an amplification product; Step 3, KASP genotyping detection is carried out on the amplification product, the signal-to-noise ratio of the corrected fluorescent signal is calculated through the following formula, and clustering is carried out on the basis of the signal-to-noise ratio so as to judge the genotype; Step 4, identifying the corn ear length character according to the genotype, and screening to obtain corn with a target long ear length; The fluorescent signal to noise ratio correction formula is: ; ; The multi-environment weighted genotype-phenotype matching degree verification formula is as follows: ; ; In the above-mentioned formula(s), For the signal-to-noise ratio after correction of the FAM channel, Is that The signal-to-noise ratio after channel correction, 、 For the measured fluorescence value of the corresponding channel of the sample well, 、 Is the background fluorescence mean value of the corresponding channel of the blank control hole, For the measured fluorescence value of sample Kong Can vs. dye ROX, The mean value of background fluorescence of the blank control hole ROX is determined as genotype judgment rule / When the temperature is not less than 10, determining that the TGA is homozygous, / When the ratio is more than or equal to 10, the plant is judged as being-homozygous and 0.1< / The identification rule of the ear length character is TGA, TGA is homozygous and TGA is corresponding to the long ear length character of heterozygous, the ear length character is corresponding to the homozygous, WMC is the multi-environment weighted matching degree, m is the total number of test environments, For the weight coefficient of the j-th environment, For the number of samples in the j-th environment whose genotype matches the phenotype, For the total number of samples detected in the j-th environment, The WMC is the generalized genetic transmission of spike length characters in the jth environment, and the WMC is not lower than 99%.
- 7. The method for screening long-spike corn using Kasp-KASP-387 according to claim 6, wherein the PCR amplification reaction system in step 2 comprises, based on 10. Mu.L, 2. Mu.L of corn genomic DNA, 0.14. Mu.L of primer set, 5. Mu.L of 2xProbeMixA solution and the balance of ddH 2 O, wherein the concentration of corn genomic DNA is 50-100 ng/mu.L, the DNA purity is required to satisfy the OD260/OD280 ratio of 1.8-2.0, the OD260/OD230 ratio is not less than 1.5, the 2xProbeMixA solution comprises hot start Taq enzyme, dNTPs, mg 2+ , FAM fluorescent labeling probe, HEX fluorescent labeling probe and PCR buffer, the concentration of Mg 2+ is 2.0-2.5 mmol/L, the concentration of dNTPs is 0.2-0.3 mmol/L, the balance of ddH 2 O is enzyme-free sterile water, and the nuclease is prevented from being polluted by a filter membrane of 0.22. Mu.m.
- 8. The method according to claim 6, wherein the PCR amplification reaction in step 2 is performed in a first stage of 95℃pre-denaturation for 10min, which is used to activate the hot start Taq enzyme and complete melting of the corn genomic DNA, in a second stage of 95℃denaturation for 20s, 61℃annealing for 40s, 10 cycles total, in which the annealing temperature is gradually reduced to 56℃in a gradient of 0.5℃per cycle, in a third stage of 95℃denaturation for 20s, 55℃annealing for 40s total of 31 cycles, which is adapted to the Tm value range of the primer set, ensuring specific binding of the primers, in a fourth stage of 25℃maintenance for 10min, and in a short-term preservation of the amplified products under 4℃conditions, the preservation time being not more than 72 hours after the end of the reaction.
- 9. The method for applying Kasp-KASP-387 to screening long corn with a mark EL-5-KASP-387 as claimed in claim 6, wherein the extraction of the genome DNA in the step 1 adopts a CTAB method, specifically, the steps are that 1.0g fresh corn leaves are weighed and sheared, 3mL of 1.5 xCTAB is added after liquid nitrogen is ground into powder, the mixture is ground into homogenate, 15mL of centrifuge tube is transferred, 1mL of 1.5 xCTAB is used for flushing a mortar and transferring the mixture into the same centrifuge tube, a 65 ℃ water bath is used for 30min and slowly shaking the mixture uniformly, an equal volume of chloroform isoamyl alcohol mixed solution is added after cooling to room temperature, the volume ratio of chloroform to isoamyl alcohol in the chloroform isoamyl alcohol mixed solution is 24:1, the centrifuge tube is gently inverted until the lower layer solution becomes dark green, 4200rpm is used for centrifugation for 10min, the upper layer water phase is transferred into a new 15mL, 2 times of absolute ethanol with a volume of precooled is added, the mixture is gently mixed, the mixture is left standing for 5min at minus 20 ℃ for 30min, the sediment DNA is placed into a refrigerator for 4200rpm for 10min, the mixture is removed, the supernatant is added into the centrifuge tube after 1mL of ethanol is gently mixed, the mixture is dried at room temperature, the mixture is dried at a pH of 50.8, and the buffer solution is added into the buffer solution for dissolving DNA solution at room temperature.
- 10. The method for applying Kasp-KASP-387 to screening long corn ears according to claim 6, wherein after step 4 is performed with screening to obtain corn ears of target long corn ears, the method further comprises a breeding step of selecting TGA (tgA) homozygous genotype long corn ears of TGA homozygous genotype long corn ears obtained by screening as a parent, performing artificial pollination according to a conventional hybridization technique to obtain F1 generation seeds, and planting; extracting leaf genome DNA at F1 generation seedling stage, repeating detection screening of step 1-step 4, retaining TGA-heterozygous genotype individual, using F1 generation heterozygous individual as female parent, backcrossing with target long spike long parent to obtain BC1F1 generation seed, after the BC1F1 generation seed is planted, making genotype detection, retaining TGA allele-carrying individual, making 3-5 generation backcrossing and selfing purification, and culturing so as to obtain stable inherited long spike long corn inbred line; The corn sample comprises one or more of a corn inbred line, a corn hybrid and a corn DH line, wherein the corn inbred line sample is suitable for homozygous genotype screening and breeding material purification, the corn hybrid sample is suitable for F1 generation spike length prediction and seed production purity detection, the corn DH line sample is suitable for genetic stability verification and marking effect analysis, the sample sampling part is fresh leaves from the corn seedling stage to the mature stage, the sampling amount is not less than 0.5g, the sampling is required to be frozen at-80 ℃ for preservation or immediately carry out DNA extraction after sampling, nucleic acid degradation is avoided, and the application covers corn samples in different planting seasons such as spring sowing, summer sowing, autumn sowing and the like.
Description
Kasp mark EL-5-KASP-387 closely linked with corn ear length and application thereof Technical Field The invention relates to the technical field of plant molecular breeding, in particular to Kasp marked EL-5-KASP-387 closely linked with the length of corn ears and application thereof. Background Along with the rapid development of molecular biology and high-throughput sequencing technology, molecular marker assisted breeding has become a core technology for crop genetic improvement, and accurate screening of target genotypes can be completed in a seedling stage through molecular markers closely linked with target traits, so that time and environment limitations of phenotype identification are broken through, and breeding efficiency and selection accuracy are greatly improved. SNP and insertion deletion Indel markers are ideal materials for molecular marker development as the most widely distributed and genetically stable genetic variation types in genome. Competitive allele-specific PCR (polymerase chain reaction), namely KASP (kaSP) technology, is a double-allele typing technology based on PCR, can finish genotype judgment only by fluorescent signal reading without gel electrophoresis separation, has the remarkable advantages of high throughput, high precision, low cost and simplicity and convenience in operation, and is widely applied to whole breeding processes such as crop gene positioning, germplasm resource identification, molecular marker assisted selection and the like, thus becoming a core genotyping platform for modern crop molecular breeding. Although the molecular marker technology is widely applied to corn breeding, the development and application of the functional molecular marker aiming at the corn ear length character still have obvious technical defects, and the practical requirements of breeding practice cannot be met. Firstly, in the existing corn ear length related QTL positioning research, a plurality of positioned genome intervals are larger, the linkage tightness degree of the markers and the ear length main effect QTL is insufficient, genetic recombination is easy to occur between the markers and target sites in breeding application, so that the selection efficiency of the markers is low, the phenotype prediction accuracy is poor, and most of the markers only stay in the theoretical research level and cannot be directly applied to large-scale breeding practice. Secondly, the disclosed molecular markers related to the corn ear length are mostly SSR markers needing gel electrophoresis detection and traditional Indel markers, the detection flux is low, the operation flow is complex, the time and the labor are consumed, the high-flux genotyping requirements of thousands of large-scale germplasm resources in modern breeding cannot be met, the developed few corn ear length KASP markers lack multiple ecological environments and system verification of large sample natural populations, the genetic effect of the markers is unstable, the phenotype prediction fitness is low in corn materials in different genetic backgrounds and different planting areas, and the application range is severely limited. Thirdly, the development of the existing corn ear length related markers is mostly based on parent separation groups, the markers can only realize effective typing in offspring materials derived from specific parents, the universality is poor in natural groups formed by corn core breeding materials in China, the markers cannot be widely applied to corn germplasm improvement of different heterosis groups and different ecological areas, and KASP functional markers which are directly related to major functional sites of the corn ear length, closely linked and strong in universality are lacking. Fourth, in the prior art, a standardized application system for the corn ear length KASP mark is lacking, a PCR reaction system and an amplification program of the mark are not subjected to system optimization, and the genotype judgment lacks a quantitative correction method and a definite judgment threshold value, so that the repeatability of detection results of different laboratories and different operators is poor, a standardized technical process from genotype detection to field breeding application cannot be formed, and the industrialized popularization and large-scale application of the mark are severely limited. Disclosure of Invention The invention aims to provide Kasp-KASP-387 marked by EL-5-KASP-387 closely linked with the length of corncob and application thereof, so as to solve the problems of long period, low efficiency and strong subjectivity of the traditional corncob color screening depending on phenotype observation in the mature period in the background technology. The invention provides Kasp-KASP-387,1 which is closely linked with the length of corn ears, kasp-labeled EL-5-KASP-387 which is closely linked with the length of corn ears, and is characterized by comprising a specific Indel site an