Search

CN-122012800-A - Primer for identifying hybridization between Chinese cabbage and cyanea based on KASP technology and application thereof

CN122012800ACN 122012800 ACN122012800 ACN 122012800ACN-122012800-A

Abstract

The application relates to the field of molecular breeding, in particular to a primer for identifying intercross seeds of Chinese cabbage and cyanea based on a KASP technology and application thereof. The identification method comprises the steps of obtaining a sample to be identified, using genomic DNA of the material as a template, amplifying by using a KASP primer pair, and detecting fluorescent signals of amplified products to judge the authenticity of the intergeneric hybrid.

Inventors

  • Duan Qiaohong
  • MENG XIANGWEN
  • ZHANG TONG
  • Huang panlong
  • WANG YANHUA
  • GUO CHAO
  • ZHU BO
  • Song Gengxing
  • Ji Zhaojing
  • LI RU
  • LI RUIXUE
  • GUO MIN

Assignees

  • 山东农业大学
  • 山东华良种业有限公司

Dates

Publication Date
20260512
Application Date
20260410

Claims (10)

  1. 1. A KASP-InDel primer pair composition for identifying the hybridization between Chinese cabbage and cyanea is characterized by comprising the following sequences of a forward primer BE-KASP1Fa with SEQ ID NO. 1, a forward primer BE-KASP1Fb with SEQ ID NO. 2 and a common reverse primer BE-KASP1R with SEQ ID NO. 3.
  2. 2. The primer pair composition according to claim 1, wherein the primer pair is designed for insertion of InDel locus into a large fragment at position 26457243 of a chromosome of chinese cabbage a05 for specific discrimination of intergeneric heterozygous genotypes of chinese cabbage and brassica juncea.
  3. 3. A kit for identifying a hybrid between chinese cabbage and cyanea, said kit comprising the primer pair composition of claim 1.
  4. 4. The kit of claim 3, further comprising reagents for a KASP-PCR reaction, comprising 2 x Taq DNA Polymerase Mix and primer mix.
  5. 5. A method for identifying the hybridization between Chinese cabbage and blue mustard genus based on KASP-InDel technology is characterized by comprising the steps of obtaining genome DNA of a sample to be identified as a template, amplifying a composition by using the primer of claim 1, detecting fluorescent signals of amplified products, and judging the authenticity of the hybridization according to the fluorescent signals.
  6. 6. The method of claim 5, wherein the amplification uses a KASP-PCR procedure comprising 10 cycles of 94℃pre-denaturation for 10 minutes, 94℃denaturation for 20 seconds and 61℃annealing for 60 seconds, each cycle being reduced by 0.6℃and 94℃denaturation for 20 seconds and 55℃annealing for 45 seconds for 35 cycles.
  7. 7. The method of claim 5 or 6, wherein the fluorescent signal detection uses FAM and VIC fluorophores to distinguish between alleles and uses ROX as a passive reference dye, read with a fluorescent quantitative PCR instrument in an environment below 40 ℃.
  8. 8. The method according to any one of claims 5 to 7, wherein the primer mixture is obtained by diluting the primer dry powder to 100 μg/mL and then diluting the three sequences in a ratio Fa: fb: R: water = 24:24:48:100.
  9. 9. The method according to any one of claims 5 to 8, wherein the KASP-PCR reaction system is 5. Mu.L of 20 ng/. Mu.L of DNA, 2. Mu.L of 2X Taq DNA Polymerase Mix, 1. Mu.L of primer mixture.
  10. 10. Use of the primer pair composition of claim 1, the kit of claim 3 or 4, or the method of claims 5 to 9 for the identification of the authenticity of intergeneric hybrids obtained by hybridization of chinese cabbage '24D4' with cyanea.

Description

Primer for identifying hybridization between Chinese cabbage and cyanea based on KASP technology and application thereof Technical Field The invention belongs to the field of molecular breeding, and in particular relates to a primer for identifying intercross seeds of Chinese cabbage and cyanea based on a KASP technology and application thereof. Background The Chinese cabbage is an important vegetable crop of Brassica genus of Brassicaceae, and plays an important role in the vegetable industry in China. The blue mustard is a plant of the genus Brassica of the family Brassicaceae, has strong adaptability, disease resistance, stress resistance and the like, and is widely applied to roads, slopes, natural sites and the like. Through distant hybridization, the excellent stress resistance property of the cyanea japonica can be transferred into cruciferous vegetables such as Chinese cabbage and the like. However, how to accurately verify the authenticity of the filial generation becomes a key link to be solved urgently. Currently, morphological and cytological assays are commonly used to identify the authenticity of hybrid offspring, and although there are also assays using molecular markers, they are difficult to design and sometimes require two or more pairs of primers to identify, which are relatively complex to manipulate. Competitive allele-specific PCR (Kompetitive ALLELE SPECIFIC PCR, KASP) genotyping SNP or InDel based on specific matching of primer terminal bases can detect the specificity of SNP or InDel. Currently, KASP-InDel typing technology is widely applied to the aspects of genetic map construction, gene positioning, germplasm resource analysis, molecular marker assisted breeding, seed purity identification and the like of plants. The true and false of the distant filial generation of the plant can be conveniently and accurately identified by developing the KASP-InDel marker. Disclosure of Invention In order to provide a molecular identification method capable of identifying the hybrid between Chinese cabbage and cyanea, the invention provides the following technology: In a first aspect, the present invention provides a KASP-InDel technique for identifying a hybrid between Chinese cabbage and Thellungiella. Comprising the following steps: Extracting sample DNA, wherein the sample is a material obtained by carrying out intergeneric hybridization by taking Chinese cabbage as a female parent and taking cyanea japonica as a male parent and carrying out embryo rescue; Using genomic DNA of the material as a template, amplification was performed using the following KASP-InDel primer pair 1: forward primer BE-KASP1Fa (5 '-3'): GAAGGTCGGAGTCAACGGATTCATCAATCGGGGAAAAAATGT(SEQ ID NO:1); Forward primer BE-KASP1Fb (5 '-3'): GAAGGTGACCAAGTTCATGCTCATGCATATCAAACCACTCAGTAAC(SEQ ID NO:2); CGGATTCTTCTCAAGTACATTATTGAA (SEQ ID NO: 3) is a common reverse primer BE-KASP1R (5 '-3'); And (3) detecting fluorescent signals of amplified products, and observing the fluorescent signals to determine the authenticity of distant hybrids. In primer set 1, BE-KASP1Fa and BE-KASP1Fb are two allele-specific forward primers, and BE-KASP1R is a common reverse primer. Further comprising amplifying the female parent, male parent and F 1 offspring hybrid with the KASP-InDel primer pair. In a specific embodiment, the primer dry powder is diluted to 100. Mu.g/mL, and the three sequences are diluted in the ratio Fa: fb: R: water=24:24:48:100 to obtain a primer mixture. In a specific embodiment, the KASP primer BE-KASP1 is used for testing in the parent chinese cabbage '24D4', the cyanea mustard and its F 1 progeny hybrid. KASP-PCR was performed on a 96-well PCR apparatus with a reaction system of 5. Mu.L of 2. Mu.L DNA (20 ng/ul), 2. Mu.L of 2X Taq DNA Polymerase Mix, 1. Mu.L of primer mix. The KASP-PCR amplification procedure was first stage, 94℃pre-denaturation for 10min, second stage, 94℃denaturation, 20 sec, 61℃annealing for 60 sec for 10 cycles (0.6℃decrease per cycle starting from the second cycle), third stage 94℃denaturation for 20 sec, 55℃annealing for 45 sec for 35 cycles; the fluorescent value reading method is to read the fluorescent value by using a fluorescent quantitative PCR instrument in an environment below 40 ℃ after the PCR amplification cycle is finished. In this method, indel site detection uses the fluorophores FAM and VIC to distinguish between the two isogenic sites. The beneficial effects of the application include: 1) The identification accuracy and reliability are improved, namely the primer pair (BE-KASP 1) based on KASP-InDel technology can specifically detect InDel locus, and the female parent Chinese cabbage, the male parent Lan Xiang mustard and heterozygous offspring thereof are distinguished through fluorescent signals (FAM and VIC), so that homozygous and heterozygous genotypes are distinguished, false hybrid misjudgment is avoided, and high-precision verification is provided. 2) The method has simple and e