Search

CN-122012809-A - ERA-Cas12a primer, probe, crRNA and kit for detecting insertion of PLCP gene into EV-G

CN122012809ACN 122012809 ACN122012809 ACN 122012809ACN-122012809-A

Abstract

The invention relates to an ERA-Cas12a primer, a probe, crRNA and a kit for detecting insertion of PLCP genes into EV-G, belonging to the technical field of animal virus molecular biology detection. The kit is provided with an ERA-Cas12a primer, a probe and crRNA for detecting the insertion of PLCP genes into EV-G, and also comprises a negative control template, a positive control template, a reverse transcription and ERA amplification reagent, a double-index nucleic acid detection test strip, cas12a protein, a FAM/Biotin reporter and a lateral flow detection test strip. The kit has the advantages of specificity, sensitivity, rapidness, high efficiency, isothermal amplification, on-site rapid diagnosis and the like, and is easy to popularize and apply.

Inventors

  • LI ZHUORAN
  • LI ZHANHONG
  • ZHANG ZHENXING
  • ZHU PEI
  • SONG JIANLING

Assignees

  • 云南省畜牧兽医科学院

Dates

Publication Date
20260512
Application Date
20251229

Claims (10)

  1. 1. The primer for detecting the insertion of the PLCP gene into the ERA-Cas12a of the EV-G is characterized by comprising an ERA-nfo-double-index nucleic acid detection test strip detection primer pair of the EV-G3D gene and an ERA-Cas12 a-lateral flow test strip detection primer pair of the PLCP gene; the ERA-nfo-double-index nucleic acid detection test strip of the EV-G3D gene detects primer pairs, comprising an upstream primer 3D_F and a downstream primer 3D_R, and the nucleotide sequences are as follows: The upstream primer 3D_F, ttaatgattctgctatgagatgctatt, (SEQ ID NO. 1); Downstream primer 3D_R, TAMRA-CAGAGCATCCTGATGGCATTCCTCCCTTAAC, (SEQ ID NO. 2); The ERA-Cas12 a-lateral flow test strip detection primer pair of the PLCP gene comprises an upstream primer PLCP_F and a downstream primer PLCP_R, and the nucleotide sequences are as follows: An upstream primer PLCP_F AATCTGTGCAAGGTTTAGTCTATCGTTTTG (SEQ ID NO. 3); the downstream primer PLCP_R is TCATCAAAAACATACCATTCACCATTAAGTT (SEQ ID NO. 4).
  2. 2. A probe for use with the primer for detecting insertion of PLCP gene into ERA-Cas12a of EV-G of claim 1, characterized in that the probe is nfo probe; the nfo probe nucleotide sequence is: 3D_Probe:DIG-tgtttgaggcccttcagatggttcttgaga[THF]aattggatttggaga[C3-spacer];(SEQ ID NO.5)。
  3. 3. a crRNA for use with the primer for detecting insertion of PLCP gene into ERA-Cas12a of EV-G of claim 1, characterized in that the nucleotide sequence of the crRNA is: crRNA:uaauuucuacuaaguguagaugagaacaacaugaugcaguuga;(SEQ ID NO.6)。
  4. 4. a kit comprising the primer for detecting insertion of PLCP gene into ERA-Cas12a of EV-G, the probe of claim 2, and the crRNA of claim 3 of claim 1.
  5. 5. The kit of claim 4, further comprising a negative control template, a positive control template, reverse transcription and ERA amplification reagents, a dual index nucleic acid detection test strip, a Cas12a protein, a FAM/Biotin reporter, and a lateral flow detection test strip.
  6. 6. The kit of claim 5, wherein the negative control template is RNase-free water, the positive control template is EV-G3D gene ssRNA fragment and PLCP gene ssRNA fragment, and the reverse transcription and ERA amplification reagent comprises RT-probe type freeze-dried microsphere, activator MC and RNase-free water.
  7. 7. The kit of claim 6, wherein the positive control template has a copy number of 5.2X10 10 copies/. Mu.L for the ssRNA fragment of the EV-G3D gene, a copy number of 5.5X10 10 copies/. Mu.L for the ssRNA fragment of the PLCP gene, a concentration of 10. Mu. Mol/L for the Cas12a protein, and a concentration of 100. Mu. Mol/L for the FAM/Biotin reporter.
  8. 8. The kit of claim 6, wherein the reverse transcription and ERA amplification system of the kit is: RT-probe type freeze-dried microsphere, 1 tube; the upstream primer 3D_F, 10. Mu. Mol/L, 1.5. Mu.L; the downstream primer 3D_R, 10. Mu. Mol/L, 1.5. Mu.L; the upstream primer PLCP_F, 10. Mu. Mol/L, 2.0. Mu.L; the downstream primer PLCP_R, 10. Mu. Mol/L, 2.0. Mu.L; nfo probe 3D_Probe, 10. Mu. Mol/L, 0.5. Mu.L; total RNA extracted from the sample to be detected is 5.0 mu L; Activator MC, 2.0. Mu.L; RNase-free water, 35.5. Mu.L; Total 50.0 μl; the reverse transcription and ERA amplification procedures were 41℃for 15min for 1 cycle, ERA amplification products were obtained, and reverse transcriptase, recombinase, polymerase and endonuclease IV were inactivated at 85℃for 10min for 1 cycle.
  9. 9. The kit of claim 8, wherein the detection system of the EV-G3D gene of the kit is: ERA amplification product, 5.0. Mu.L; ddH 2 O,200.0μL; A total of 205.0. Mu.L; Inserting double-index nucleic acid detection test paper into a detection system of the EV-G3D gene for detection, wherein the liquid level does not exceed a Max line of the double-index nucleic acid detection test paper; the detection procedure is at room temperature for 7-10min.
  10. 10. The kit of claim 8, wherein the cleavage system for the PLCP gene Cas12a protein of the kit is: ERA amplification product, 45.0. Mu.L; 10×Reaction Buffer,6.0μL; cas12a protein, 10 μmol/L,2.0 μl; FAM/Biotin reporter, 100. Mu. Mol/L, 0.6. Mu.L; crRNA,10μmol/L,0.6μL; ddH 2 O,5.8μL; A total of 60.0. Mu.L; the cleavage procedure is 40 ℃ for 30min for 1 cycle, cas12a protein cleavage product is obtained, cas12a protein inactivation is 85 ℃ for 5min for 1 cycle; the detection system of the PLCP gene of the kit is as follows: 30.0 μl of Cas12a protein cleavage product; ddH 2 O,30.0μL; A total of 60.0. Mu.L; the lateral flow detection test strip is inserted into the detection system of the PLCP gene for detection, and the liquid level does not exceed the Max line of the lateral flow detection test strip; the detection procedure is at room temperature for 7-10min.

Description

ERA-Cas12a primer, probe, crRNA and kit for detecting insertion of PLCP gene into EV-G Technical Field The invention belongs to the technical field of animal virus molecular biology detection, and particularly relates to an ERA-Cas12a primer, a probe, crRNA and a kit for detecting insertion of PLCP genes into EV-G. Background Porcine enterovirus (Enterovirus G, EV-G) is a member of the picornaviridae (Picornaviridae) family, and is transmitted mainly by the faecal route, and is widely prevalent in swine herds worldwide, and is mostly a recessive infection. However, with the continuous discovery of EV-Gs having insertion of papain (papain-LIKE CYSTEINE protease, PLCP) genes of porcine circovirus (porcine torovirus, PToV) of the order Neuroviridae (Nidovirales) coronaviridae (Coronaviridae) including various genotypes of EV-G1, 2, 8, 10, 12 and 17, there is increasing evidence that insertion of PLCP genes may be responsible for antagonizing the native immune system of host cells in Belgium, america, korea, japan and China, and that EV-G-PLCP strain infection is often associated with clinical symptoms such as diarrhea, fever and daily gain decline of piglets, as well as necropsy and pathological features such as enteritis, intestinal mucosa and multiple intestinal lymph nodes, thinning of intestinal wall and small intestinal villus shedding. EV-Gs have a single-stranded positive-strand RNA genome of length 7400 to 7500 nucleotides (nt) and contain only one open reading frame, which encodes a multimeric protein precursor that can be cleaved by proteases to yield 4 structural proteins (VP 1 to VP 4) and 7 nonstructural proteins (2 Apro, 2B, 2C, 3A, 3B, 3Cpro and 3 Dpol), where the diversity of VP1 protein-encoding genes is a molecular biological basis for the EV-Gs further divided into 20 genotypes (genotype, EV-G1-20), while 3Dpol protein is an RNA-dependent RNA polymerase (RNA-DEPENDENT RNA polymerase, rdRp), which plays an important role in the viral life cycle, its encoding genes being 3D genes. The 3D gene is highly conserved among single-stranded positive-strand RNA viruses and is often used as a basis for classification of members of the picornaviridae family. The damage of intestinal barrier caused by virus infection is one of important factors for causing the absorption of nutrition, the low immunity and the decline of production performance of piglets, and frequent intestinal diseases can also cause food and environmental safety problems such as antibiotic abuse. In order to grasp the popularity and distribution of EV-Gs with PLCP gene insertion in China and to formulate a scientific prevention and control strategy, it is very necessary to establish a corresponding on-site rapid diagnosis method. Real-time fluorescent quantitative polymerase chain reaction (quantitative real-time polymerase chain reaction, qRT-PCR) and visual loop-mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) methods have been developed by Li Zhanhong et al for detection of EV-Gs, but all of the above detection methods have disadvantages. Firstly, the qRT-PCR detection method needs to be provided with expensive instruments (about 30 ten thousand yuan), secondly, trained technicians are required to carry out experimental operation, thirdly, the qRT-PCR detection process needs to be subjected to a temperature-changing circulation process of denaturation (95 ℃) and extension (72 ℃) and the like which are strictly controlled, and field detection is difficult to provide stable power supply, and finally, the currently established qRT-PCR detection method has a target sequence of only EV-Gs genome but not PLCP gene. Although the visible LAMP detection method can complete amplification under isothermal and isothermal conditions, reduces the requirement on a temperature-changing circulation process, and can judge the detection result by naked eyes, the method can complete an amplification reaction by at least two pairs of primers, and can not be used for detecting two or more virus genes because primer dimers are easily formed among the pairs of primers to cause non-specific amplification. Therefore, the method can only determine whether the sample to be detected is EV-G positive, but cannot determine whether PLCP gene insertion exists in the genome of the sample to be detected, and the detection efficiency is seriously reduced. In summary, at present, there is no detection method which has the advantages of specificity, sensitivity, high efficiency, convenience and the like, and especially lacks means for early and rapid diagnosis of clinical samples on site. Therefore, the EV-Gs etiology detection method and the detection kit which are suitable for on-site rapid diagnosis and have PLCP gene insertion are established, so that the defects of the prior art can be overcome, and technical support and knowledge reserve can be provided for diagnosis, prevention and control of EV-Gs in China. Over the past several d