CN-122012811-A - Primer probe combination for rapidly and simultaneously detecting bovine astrovirus and bovine norovirus and detection method thereof
Abstract
The invention belongs to the technical field of biology, in particular to a primer probe combination and a kit for rapidly and simultaneously detecting bovine astrovirus and bovine norovirus and a detection method thereof, which aim at the problems of long detection time and complex detection equipment of the existing method for simultaneously detecting bovine astrovirus and bovine norovirus, according to the BAstV and BNOV gene sequences published by GenBank, the invention designs a specific primer group for detecting the bovine norovirus and the bovine astrovirus by adopting Oligo 6.0 software for the BAstV ORF and BNoV RdRp gene conservation regions, and the primer pair, the probe and the method have the advantages of simple operation, strong specificity, high detection rate, high sensitivity, good repeatability and the like.
Inventors
- JIANG LINGLING
- YU BO
- WAN FACHUN
- AI RONG
- ZHANG QIN
- LUO WENJU
- ZHOU JINGRUI
Assignees
- 贵州省畜牧兽医研究所
Dates
- Publication Date
- 20260512
- Application Date
- 20260119
Claims (6)
- 1. The primer probe combination for rapidly and simultaneously detecting bovine astrovirus and bovine norovirus is characterized in that primers in the primer probe combination are AstV-F1, astV-R3, BNoV-F3 and BNoV-R1 respectively, and the nucleotide sequences are as follows: AstV-F1(5’→3’):GAGGATGCAGATGATGAAGATGACGAGGTT; AstV-R3(5’→3’):GGGTGCAGCTCACAAAGGATCTCATAGGTT; BNoV-F3(5’→3’):TCCATGGTGACCGCAGAGGCCAAGGAA; BNoV-R1(5’→3’):TCCTGATTATCCTTGTCAGTCATCTTCATT; Probes in the primer probe combination are AstV-P and BNoV-P respectively, and the nucleotide sequences are as follows: modification AstV-P (5 '. Fwdarw.3') ACAGATGCCGACCTTGAGCTCGGTCCCATGGA/iHEXdT// idSp/A/iBHQ1dT/TATGATGATCCACC-C3 Spacer; Modification BNoV-P (5 '. Fwdarw.3') TCGCACCGCTCCATGTTTGCTTGGATGAGATT/i6FAMdT// idSp/A/iBHQ1dT/GATTTGTCGCTGTG-C3 Spacer.
- 2. The primer probe combination for rapidly and simultaneously detecting bovine astrovirus and bovine norovirus according to claim 1, wherein BNoV-F3 and BNoV-R1 are designed by using RdRp gene of bovine norovirus as a template, and AstV-F1 and AstV-R3 are designed by using ORF2 gene of bovine astrovirus as a template.
- 3. The primer probe combination for rapidly and simultaneously detecting bovine astrovirus and bovine norovirus according to claim 1, wherein the 5 'end of the probe is labeled with a fluorescent group and the 3' end of the probe is labeled with a quenching group.
- 4. A primer probe combination for rapid simultaneous detection of bovine astrovirus and bovine norovirus as claimed in claim 3, wherein the fluorescent group is any one of FAM and HEX and the quenching group is BHQ1.
- 5. A dual isothermal RT-PCR assay for rapid simultaneous detection of bovine norovirus and bovine astrovirus, said assay being for non-diagnostic purposes comprising the steps of: 1) Designing and synthesizing a primer; 2) The construction of recombinant plasmid standard products, namely carrying out single constant temperature fluorescent PCR amplification reaction by taking BAstV strain and BNoV strain as templates respectively, recovering PCR products by a gel recovery kit to obtain target fragments, connecting the target fragments to a pMD18-T vector, transforming DH5 alpha competent cells, carrying out sequencing and identification to be positive, sequentially carrying out amplification culture, extracting plasmids by using a common plasmid extraction kit, and calculating the recombinant plasmids to be named pMD-18T-BAstV and pMD-18T-BNoV, wherein the single constant temperature fluorescent PCR amplification reaction system comprises an A buffer 29.4 mu L, an upstream primer and a downstream primer respectively 2.0 mu L, a concentration of 10 mu M, a probe of 0.6 mu L, a template of 5 mu L and a B buffer 2.5 mu L, and supplementing the target fragments to 50 mu L by using ddH 2 O, and the amplification procedures comprise 39 ℃,30s and 40cycles; 3) Extracting RNA, namely directly immersing the fecal swab into a centrifuge tube containing a nucleic acid releasing agent, and sequentially carrying out shaking and mixing, standing and instantaneous separation to obtain RNA of a sample to be detected; 4) Preparing 50 mu L of amplification reaction products by taking the recombinant plasmid standard product obtained in the step 1) and the RNA of the sample to be detected obtained in the step 2) as detection templates respectively according to the double constant temperature fluorescent quantitative PCR amplification reaction, wherein the double constant temperature fluorescent quantitative PCR amplification reaction system comprises 5 mu L of templates, 29.4 mu L of A buffer, 1.5 mu L of upstream and downstream primers with the concentration of 10 mu M, 0.6 mu L of AstV-P, 2.5 mu L of B buffer, 1 mu L of upstream and downstream primers with the concentration of 10 mu M and 0.3 mu L of BNoV-P, and supplementing to 50 mu L with ddH 2 O, and the amplification procedures comprise 39 ℃ for 30s and 40cycles, and collecting fluorescent signals; 5) And (3) detecting results, namely drawing an amplification curve through a fluorescence quantitative PCR instrument and reading corresponding Ct values to judge the results.
- 6. The method for rapid simultaneous detection of bovine norovirus and bovine astrovirus according to claim 5, wherein the concentration of the recombinant plasmid pMD-18T-BAstV is 197 ng/. Mu.L and the concentration of the recombinant plasmid pMD-18T-BNoV is 241.7 ng/. Mu.L.
Description
Primer probe combination for rapidly and simultaneously detecting bovine astrovirus and bovine norovirus and detection method thereof Technical Field The invention belongs to the technical field of biology, and particularly relates to a primer probe combination for simultaneously detecting bovine astrovirus and bovine norovirus and a detection method thereof. Background Viral diarrhea is an important infectious disease that jeopardizes the herd of calves, resulting in diarrhea, reduced milk production, reduced immunity, and even affecting the long-term growth performance of calves. Thus, establishing a rapid, sensitive and suitable method for on-site detection is of great importance for early detection of diarrhea and identification of disorders. Bovine astrovirus (bovine astrovirus, boAstV) belongs to the family astroviridae, the genus astrovirus, a single-stranded positive strand RNA virus, has extremely high bovine astrovirus positive rate, and can cause diarrhea and nervous system symptoms in animals. Niu Nuo viruses such as viruses (Bovine norovirus, BNoV) are capless single strand positive strand RNA viruses of the genus Caliciviridae, norovirus, whose role in calf diarrhea is often ignored as it is often co-infected with other diarrhea viruses. However, boAstV and BNoV have been popular in chinese farms for the last two years, but there is currently no rapid diagnostic method in China specifically for both BoAstV and BNoV viruses. In view of the above, the research successfully establishes a constant temperature fluorescence rapid detection method based on the gene conservation regions of BoAstV and BNoV, and provides reliable technology and powerful support for pathogen identification and molecular epidemiology research of bovine diarrhea. The real-time fluorescent quantitative PCR is used as an internationally recognized virus detection gold standard, has multiple advantages of rapidness, simplicity, convenience, safety, high sensitivity, quantification and the like, and is widely applied to clinical detection. Although the literature reports on the establishment and application of dual PCR detection methods of bovine astrovirus and bovine norovirus (Wang Wenjia et al in 2020) that fluorescent PCR methods capable of simultaneously detecting the two viruses are available, the detection process still takes about 2 hours, which is equivalent to the time consumption of conventional PCR, and the detection equipment is complex, such as a thermal cycler, so that the urgent clinical requirement for rapid detection cannot be satisfied. Disclosure of Invention The invention aims to solve the problems of long detection time, complex detection equipment and the like of the existing method for simultaneously detecting the bovine astrovirus and the bovine norovirus, and provides a primer probe combination for simultaneously detecting the bovine astrovirus and the bovine norovirus and a detection method thereof. The technical scheme of the invention is as follows: The first object of the invention is to provide a primer probe combination for simultaneously detecting bovine astrovirus and bovine norovirus, wherein the primers in the primer probe combination are AstV-F1, astV-R3, BNoV-F3 and BNoV-R1 respectively, and the nucleotide sequences are as follows: AstV-F1(5’→3’):GAGGATGCAGATGATGAAGATGACGAGGTT; AstV-R3(5’→3’):GGGTGCAGCTCACAAAGGATCTCATAGGTT; BNoV-F3(5’→3’):TCCATGGTGACCGCAGAGGCCAAGGAA; BNoV-R1(5’→3’):TCCTGATTATCCTTGTCAGTCATCTTCATT; Probes in the primer probe combination are AstV-P and BNoV-P respectively, and the nucleotide sequences are as follows: modification AstV-P (5 '. Fwdarw.3') ACAGATGCCGACCTTGAGCTCGGTCCCATGGA/iHEXdT// idSp/A/iBHQ1dT/TATGATGATCCACC-C3 Spacer; Modification BNoV-P (5 '. Fwdarw.3') TCGCACCGCTCCATGTTTGCTTGGATGAGATT/i6FAMdT// idSp/A/iBHQ1dT/GATTTGTCGCTGTG-C3 Spacer. BNoV-F3 and BNoV-R1 are designed by taking RdRp genes of bovine norovirus as templates, and AstV-F1 and AstV-R3 are designed by taking ORF2 genes of bovine astrovirus as templates; the primer and probe as described above, preferably, the 5 'end of the probe is labeled with a fluorescent group and the 3' end of the probe is labeled with a quenching group. Preferably, the fluorescent group is either FAM or HEX, and the quenching group is BHQ1. It is a second object of the present invention to provide a kit for simultaneous detection of bovine astrovirus and bovine norovirus, comprising the aforementioned primers and probes. The kit further comprises an enzyme buffer solution. The third object of the present invention is to provide a dual RT-PCR detection method for simultaneously detecting bovine norovirus and bovine astrovirus, which is a detection method for non-diagnostic purposes, comprising the steps of: 1) Designing and synthesizing primers, namely designing the primer probes by adopting Oligo 6.0 software according to the BAstV and BNOV gene sequences published by GenBank and aiming at BAstV ORF and BNoV RdRp gene conserv