Search

CN-122029277-A - Engineered class 2V-type CRISPR system

CN122029277ACN 122029277 ACN122029277 ACN 122029277ACN-122029277-A

Abstract

Provided herein are systems of engineered class 2V nucleases and guide ribostents useful for editing target nucleic acids. Methods of making such systems and using the systems to modify nucleic acids are also provided.

Inventors

  • F. DeYiTe
  • ZHOU WENYUAN
  • M. Moha
  • B. Oaks
  • S. Higgins
  • S. Dunni
  • G. VIJAYA KUMAR
  • T. Gomberg
  • A. WRIGHT

Assignees

  • 斯克里贝治疗公司

Dates

Publication Date
20260512
Application Date
20230601
Priority Date
20220602

Claims (20)

  1. 1. An engineered ribonucleic acid scaffold (ERS) comprising or having at least about 70% sequence identity to the sequence of SEQ ID No. 17, said ERS comprising an elongated stem loop sequence of SEQ ID No. 49739 and one or more mutations at a position selected from the group consisting of U11, U24, a29 and a87.
  2. 2. The engineered ERS of claim 1, comprising mutations at positions U11, U24, a29, and a 87.
  3. 3. The engineered ERS of claim 1, comprising one or more mutations selected from the group consisting of U11C, U24C, A C and a87G.
  4. 4. The engineered ERS of claim 3, comprising a mutation consisting of U11C, U, C, A, 29C and a 87G.
  5. 5. An engineered ribonucleic acid scaffold (ERS) comprising or having at least about 70% sequence identity to the sequence of SEQ ID No. 75, the ERS modified to comprise the extended stem loop sequence of SEQ ID No. 49739.
  6. 6. The ERS of claim 5, the sequence comprising a region selected from the group consisting of: a.5 'end, said 5' end comprising a sequence of AC; b. a pseudoknot stem I comprising the sequence of UGGCGCU; c. A triplet ring comprising the sequence of SEQ ID No. 49736; d. pseudoknot II comprising a sequence of AGCGCCA, and E. A triplet region III comprising the sequence of CAGAG.
  7. 7. An engineered ribonucleic acid scaffold (ERS) comprising the sequence of ACUGGCGCUUCUAUCUGAUUACUCUGAGCGCCAUCACCAGCGACUA UGUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAGAG (SEQ ID NO: 156) or a sequence having at least about 96% sequence identity thereto.
  8. 8. An engineered ribonucleic acid scaffold (ERS) comprising a sequence having at least about 70% sequence identity to: (i) ACUGGCACUUCUAUCUGAUUACUCUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCCGCUUACGGACUUCGGUCCGUAAGAGGCA UCAGAG(SEQ ID NO:61); Or (ii) ACUGGCGCUUCUAUCUGAUUACUCUGAGCGCCAUCACCAGCGACUA UGUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAGAG(SEQ ID NO:156); The ERS comprises one or more modifications in the sequence, wherein the one or more modifications result in improved properties compared to unmodified SEQ ID NO:61 or SEQ ID NO: 156.
  9. 9. The ERS of claim 8, comprising at least two modifications in the sequence, wherein the mutation results in improved properties compared to unmodified SEQ ID No. 61 or SEQ ID No. 156.
  10. 10. ERS according to claim 8 or claim 9, wherein the modification comprises: a. substitution of 1 to 30 consecutive nucleotides in one or more regions of the scaffold; b. a deletion of 1 to 10 consecutive nucleotides in one or more regions of the scaffold; c. insertion of 1 to 10 consecutive nucleotides in one or more regions of the scaffold; d. replacing the scaffold stem loop with an RNA stem loop sequence from a heterologous RNA source; e. substitution of an extended stent stem loop with an RNA stem loop sequence from a heterologous RNA source, or F. (a) Any combination of (d).
  11. 11. The ERS of any one of claims 8 to 10, wherein the modification comprises a mutation in one or more regions selected from the group consisting of the 5' end, pseudonode stem, triplet loop, scaffold stem loop, extended stem loop and triplet region III.
  12. 12. The ERS of any one of claims 8 to 10, wherein the modification comprises a mutation in at least two regions of the ERS, wherein the regions are selected from the group consisting of the 5' end, pseudoknot stem I, triplet loop, pseudoknot stem II, scaffold stem loop, elongated stem loop and triplet region III.
  13. 13. ERS according to any one of claims 8 to 12, wherein the mutations are selected from the group consisting of the mutations of tables 44, 45 and 47.
  14. 14. ERS according to claim 13, wherein the sequence of the mutated region alone has the sequence: SEQ ID NOS in the 5' end region 739-753; b. SEQ ID NOS in the triplet loop region 754-772; c. 773-791 in the triplet region; d. SEQ ID NOS 792-841 in the pseudo junction region; e. SEQ ID NO 842-869 in the stem region of the scaffold, and/or F. SEQ ID NOS 870-907 in the extended stem region.
  15. 15. The ERS of claim 13, wherein the ERS comprises paired combinations of separate mutated sequences from different regions or the same region.
  16. 16. The ERS of claim 15, wherein the ERS comprises or has at least 70% sequence identity to a sequence selected from the group consisting of SEQ ID NOs 11,568-22,227 and 23,572-24,915.
  17. 17. The ERS of claim 15, wherein the ERS comprises a sequence selected from the group consisting of SEQ ID NOs 11,568-22,227 and 23,572-24,915.
  18. 18. ERS according to any one of claims 7 to 17, wherein the scaffold has 85-100 nucleotides or any integer therebetween.
  19. 19. An ERS comprising a sequence selected from the group consisting of SEQ ID NOs 156, 739-907, 11568-22227, 23572-24915 and 49719-49735, or a sequence having at least about 90%, at least about 95%, at least about 98% or at least about 99% sequence identity thereto, wherein said ERS comprises improved properties compared to the sequence of SEQ ID NO 17.
  20. 20. The ERS of claim 19, wherein the ERS comprises a sequence selected from the group consisting of SEQ ID NOs 156, 739-907, 11568-22227, 23572-24915 and 49719-49735, wherein the ERS comprises improved properties compared to the sequence of SEQ ID NO 17 when assayed in an in vitro cell-based assay under comparable conditions.

Description

Engineered class 2V-type CRISPR system Cross reference to related applications The present application claims priority from U.S. provisional patent application No. 63/348,413 filed on month 2 of 2022, U.S. provisional patent application No. 63/350,400 filed on month 8 of 2022, and U.S. provisional patent application No. 63/350,770 filed on month 9 of 2022, the contents of each of which are incorporated by reference in their entirety. Incorporated by reference into the sequence listing The contents of the electronic sequence listing (SCRB _041_03wo_seqlist_st26.Xml; size: 90,175,867 bytes; and date of creation: 2023, 5, 23 days) are incorporated herein by reference in their entirety. Background The CRISPR-Cas system of bacteria and archaea confers a form of acquired immunity against phages and viruses. Extensive research in the last decade has revealed the biochemistry of these systems. A CRISPR-Cas system consists of a Cas protein that participates in the collection, targeting and cleavage of exogenous DNA or RNA and a CRISPR array that includes direct repeats of flanking short spacer sequences that direct the Cas protein to its target. Class 2 CRISPR-Cas is a simplified version in which a single Cas protein that binds to RNA is responsible for binding to and cleaving a targeting sequence. The programmable nature of these minimal systems facilitates their use as general-purpose techniques that are drastically changing the field of genome manipulation. To date, only a few widely used class 2 CRISPR/Cas systems have been discovered. Among them, V-type is unique in that it utilizes a single unified RuvC-like endonuclease (RuvC) domain that recognizes a 5' PAM sequence that is different from the 3' PAM sequence recognized by Cas9 and forms a staggered cut with 5, 7, or 10nt 5' projections in the target nucleic acid (Yang et al, PAM-dependent target DNA recognition and cleavage by C2C1 CRISPR-Cas endonuclease (PAM-DEPENDENT TARGET DNArecognition AND CLEAVAGE by C2C1 CRISPR-Cas endonulose) & Cell (Cell) 167:1814 (2016)). However, wild-type V-type Cas nucleases and guide sequences have low editing efficiency. Accordingly, there is a need in the art for additional class 2V CRISPR/Cas systems (e.g., cas protein plus guide RNA combinations) that have been optimized and provide improvements over previous generation systems for use in a variety of therapeutic, diagnostic, and research applications. Disclosure of Invention The present disclosure relates to systems of engineered CasX proteins and engineered guide ribonucleic acid scaffolds (ERS) with linked targeting sequences for modifying target nucleic acids of genes in eukaryotic cells. In some embodiments, the present disclosure provides engineered CasX proteins comprising one or more modifications or multiple modifications relative to one or more domains of the CasX protein from which they are derived. These engineered CasX exhibit one or more improved properties compared to reference CasX or CasX variants derived therefrom, and the engineered CasX retains the ability to form Ribonucleoprotein (RNP) complexes with ERS and retains nuclease activity. In another aspect, the present disclosure provides engineered guide ribonucleic acid scaffolds (ERS) comprising a unidirectional guide composition, the ERS being capable of binding to a class 2V protein comprising an engineered CasX of the present disclosure, wherein the ERS comprises one or more modifications in one or more regions or a plurality of modifications as compared to a parent gRNA, e.g., a reference gRNA or a gRNA variant. In some embodiments, the modified region of the scaffold of the gRNA comprises one or more of (a) a 5' end of a scaffold, (b) an elongated stem, (c) a scaffold stem, (d) a triplet, (e) a triplet loop, and (f) a pseudoknot stem. In some embodiments, the present disclosure provides a system of gene editing pairs comprising engineered CasX proteins and ERS according to any of the embodiments described herein, wherein the gene editing pairs exhibit at least one improved property as compared to the gene editing pairs of CasX and gRNA from which the engineered CasX proteins and ERS are derived. In some embodiments, the present disclosure provides polynucleotides and vectors encoding the engineered CasX protein, ERS, and gene-editing pairs described herein. In some embodiments, the vector is a viral vector, such as an adeno-associated virus (AAV) vector. In other embodiments, the vector is CasX delivery particles (XDP) comprising RNP of a gene editing pair. In some embodiments, the disclosure provides methods of making the engineered CasX proteins. In other embodiments, the present disclosure provides methods of making the ERS. In some embodiments, the disclosure provides a kit comprising a polynucleotide, a vector, an engineered CasX protein, ERS and gene-editing pairs, and an LNP composition described herein. In some embodiments, the present disclosure provides methods of editing a target nuclei