Search

EP-3411480-B1 - TREATMENT OF ATOPIC DERMATITIS AND ASTHMA USING RNA COMPLEXES THAT TARGET LL4R, TRPA1, OR F2RL1

EP3411480B1EP 3411480 B1EP3411480 B1EP 3411480B1EP-3411480-B1

Inventors

  • LEE, DONG-KI
  • HONG, SUN WOO
  • LEE, Hanna
  • YU, DAYEON
  • EOM, JI

Dates

Publication Date
20260513
Application Date
20170201

Claims (15)

  1. An RNA complex comprising: i) an antisense strand of at least 19 nucleotides (nt) in length having sequence complementarity to an F2RL1 mRNA sequence, and ii) a sense strand having the sequence of 5' CUGACCUCCUCUCUGU 3' that is complementary to the antisense strand, wherein the antisense strand and the sense strand form a complex in which the 5' end of the antisense strand and the 3' end of the sense strand form a blunt end, and wherein the RNA complex is capable of inhibiting F2RL1 expression by a cell.
  2. The RNA complex of claim 1, wherein the antisense strand is 19 to 21 nt, 19 nt, 20 nt, 21 nt, or at least 24 nt in length.
  3. The RNA complex of claim 1 or claim 2, wherein the antisense strand has a sequence selected from the antisense strand sequences listed in Table 7, Table 9, and Table 10.
  4. The RNA complex of any one of claims 1 to 3, wherein the RNA complex comprises the antisense strand having the sequence of 5' ACAGAGAGGAGGUCAGCCAAG 3'.
  5. The RNA complex of claim 4, wherein the cell is an epithelial cell, a keratinocyte, an alveolar cell, or an A549 cell.
  6. The RNA complex of any one of claims 1 to 5, wherein the RNA complex comprises a chemical modification, wherein preferably (a) the RNA complex comprises a hydrophobic moiety, the hydrophobic moiety preferably being a cholesterol moiety, the cholesterol moiety preferably being attached to the 3' terminus of the sense strand; (b) the RNA complex comprises a 2'-0-methylated nucleoside, (b-i) the 2'-0-methylated nucleoside preferably being positioned at the 3' terminus of the sense strand, wherein preferably the 3' terminal region of the sense strand comprises a plurality of 2'-0-methylated nucleosides; (b-ii) the 2'-0-methylated nucleoside preferably being positioned at the 3' terminus of the antisense strand, wherein preferably the 3' terminal region of the antisense strand comprises a plurality of 2'-0-methylated nucleosides; or (b-iii) a 2'-0-methylated nucleoside preferably being positioned at the 3' terminus of the sense strand and at the 3' terminus of the antisense strand, wherein preferably the 3' terminal region of the sense strand comprises a plurality of 2'-0-methylated nucleosides and the 3' terminal region of the antisense strand comprises a plurality of 2'-0-methylated nucleosides; or (c) the RNA complex comprises a phosphorothioate bond, wherein preferably (c-i) at least 25%, at least 50%, at least 75% or all of the bonds between the ribonucleotides in the sense strand of the RNA complex are phosphorothioate bonds; and/or (c-ii) at least 25%, at least 50%, at least 75% or all of the bonds between the ribonucleotides in the antisense strand of the RNA complex are phosphorothioate bonds.
  7. The RNA complex of claim 6, wherein the RNA complex is a modified RNA complex listed in Table 9 or Table 10.
  8. The RNA complex of claim 6, wherein the RNA complex is capable of penetrating the cellular membrane of a cell in the absence of a delivery vehicle.
  9. The RNA complex of any one of claims 1 to 8, wherein the RNA complex is not cytotoxic.
  10. An in vitro method of inhibiting F2RL1 expression by a cell comprising contacting the cell with an RNA complex of any one of claims 1 to 9, wherein methods of treatment of the human or animal body are excluded, wherein preferably the cell is an A549, an epithelial cell or a keratinocyte.
  11. A pharmaceutical composition comprising an RNA complex of any one of claims 1 to 9 and a pharmaceutically acceptable carrier, wherein preferably the pharmaceutical composition is (a) formulated for inhalation; (b) formulated for an inhaler (c) formulated for topical administration; or (d) a cream or a lotion.
  12. An RNA complex of any one of claims 1 to 9 for use in the treatment of atopic dermatitis or asthma, wherein preferably the RNA complex is to be administered to the skin of the subject, to the respiratory tract of the subject, intravenously, parenterally, topically, or by inhalation.
  13. The RNA complex of claim 12, wherein the RNA complex is to be self-administered.
  14. The pharmaceutical composition of claim 11 for use in the treatment of atopic dermatitis or asthma, wherein preferably the pharmaceutical composition is to be administered to the skin of the subject, to the respiratory tract of the subject, intravenously, parenterally, orally, topically, or by inhalation, wherein preferably a second agent for the treatment of atopic dermatitis or a second agent for the treatment of asthma is to be administered, said second agent preferably being a steroid or an immunomodulator.
  15. The pharmaceutical composition of claim 14, wherein the pharmaceutical composition is to be self-administered.

Description

BACKGROUND Dysregulation of the immune system can result in autoimmune diseases such as atopic dermatitis and asthma. Atopic dermatitis, also referred to as eczema, is an inflammatory disease characterized by the presence of itchy and tender skin, edema, and erythema. Atopic dermatitis is common in children and infants, although the disease can occur at any age. About 70% of atopic dermatitis patients develop asthma by "atopic march," characterized by the progression of atopic dermatitis to asthma and allergic rhinitis. Asthma is a respiratory disorder also associated with dysregulation of the immune system. More specifically, it is a chronic respiratory disease marked by respiratory spasms and obstruction due to allergic inflammation of the bronchi, causing repetitive breathing shortness, wheezing and coughing. Asthma prevalence is estimated to be as high as 300 million individuals worldwide, and about 8% of the population of major developed countries are afflicted with asthma. IL4Rα, F2RL1 and TRPA1 genes play a key role in the onset and progression of symptoms of atopic dermatitis and/or asthma. When exposed to foreign antigens, dendritic cells in atopic dermatitis patients activate Th2 cells, leading to the secretion of cytokines (e.g., IL-4, IL-5, IL-10, and IL-13) by the activated Th2 cells. Among the cytokines, IL-4 and IL-13 are known to play an important role in the onset of atopic dermatitis, while IL-4 and IL-13 have been reported to worsen atopic dermatitis symptoms of through the inhibition of human beta defensin-3 and filaggrin, both of which maintain the skin barrier. The receptors for IL-4 and IL-13 are heterodimers and contain IL4Rα (interleukin 4 receptor, alpha, also known as IL4Rα). Therefore, down-regulation of the IL4Rα can block out the signals of IL-4 and IL-13. The main cause of the itching symptom experienced by atopic dermatitis patients is the overexpression of thymic stromal lymphopoietin (TSLP) in keratinocytes, which elevates the transient receptor potential (TRP) of TRP ion channels, including TRPV1 and TRPA1. Thus, the symptoms of atopic dermatitis can be treated by the inhibition of TRPA1. Coagulation factor II (thrombin) receptor-like 1 (F2RL1, also known as protease-activated receptor 2, PAR2) is expressed by keratinocytes, activated endothelial cells, and sensory nerves in the skin and is involved in various inflammation reactions, pigmentation production, and the skin barrier function. F2RL1 plays a pivotal role in the activation of proteinases, which induce inflammation reactions and the aggravated skin conditions seen in atopic dermatitis patients. Thus, there is a need for new and improved therapeutics targeting IL4Rα, TRPA1 and F2RL1 for the treatment or atopic dermatitis or asthma. Functional RNA compounds, such as siRNAs, targeting F2RL1 have been reported previously and can be found in Bhagwat et al., Food and Chemical Toxicology 69:303-311 (2014), Liu et al, Archives of Biochemistry and Biophysics 535: 234-240 (2013), Larsen et al., Toxicology and Applied Pharmacology 230: 276-282 (2008) and Julovi et al., American Journal of Pathology 179: 2233-2242 (2008). SUMMARY Described herein are RNA complexes that target IL4Rα, TRPA1, or F2RL1 and are useful for treating and/or preventing atopic dermatitis and/or asthma. Described herein are pharmaceutical compositions comprising such RNA complexes and methods of using such RNA complexes and pharmaceutical compositions. In certain aspects, provided herein is an RNA complex comprising an antisense strand having sequence complementarity to an F2RL1 mRNA sequence and a sense strand having sequence complementarity to the antisense strand. The RNA complex is capable of inhibiting F2RL1 expression by a cell (e.g., a keratinocyte). In some examples, the RNA complex is an asymmetric shorter-duplex small interfering RNA (an asiRNA). The RNA complex is an RNA complex listed in Table 7, Table 9, or Table 10. In one embodiment, the RNA complex comprises the antisense and sense strand of F2RL1#22. The RNA complex provided herein comprises a chemical modification, wherein the modification facilitates the penetration of a cellular membrane in the absence of a delivery vehicle. In one embodiment, the modification is a 2'-O-methylated nucleoside, a phosphorothioate bond or a hydrophobic moiety. In one embodiment, the RNA complexes provided herein comprise a hydrophobic moiety. In some examples, the hydrophobic moiety can be any chemical structure having hydrophobic character. For example, the hydrophobic moiety is a lipid, a lipophilic peptide and/or a lipophilic protein. In some examples, the hydrophobic moiety is a lipid, such as cholesterol, tocopherol, or a long-chain fatty acid having 10 or more carbon atoms (e.g., stearic acid or palmitic acid). In one embodiment, the hydrophobic moiety is cholesterol. In one embodiments, the RNA complex is a modified RNA complex listed in Table 9, or Table 10. In one embodiment, the RNA complex is