Search

EP-3768839-B1 - ANTISENSE OLIGONUCLEOTIDES AND USES THEREOF

EP3768839B1EP 3768839 B1EP3768839 B1EP 3768839B1EP-3768839-B1

Inventors

  • Hernández Ribera, Jordi
  • Valcárcel Juárez, Juan Alberto
  • Bechara, Elias
  • SERRANO MARUGÁN, Manuel
  • ROVIRA DEL OLMO, Miguel
  • Fernández Marcos, Pablo José

Dates

Publication Date
20260506
Application Date
20190319

Claims (16)

  1. An antisense oligonucleotide for reducing inclusion of NUMB exon 9 in a population of mature NUMB transcripts for use in the treatment of a proliferative disease, such as a tumour or a cancer, the antisense oligonucleotide comprising a sequence of at least 7 nucleotides that is complementary to a target region within exon 9 (SEQ ID NO: 2) of a NUMB transcript; wherein the target region is comprised within the sequence, CUAAUGGCACUGACUCAGCCUUCCAUGUGCUUGCUAAGCCAGCCCAUACU (SEQ ID NO: 305), CCGUAGCAAUGCCUGUGCGUGAAACCAACCCUUGGGCCCAUG (SEQ ID NO: 10), GCUAACAAGGAAAUUGCAGCC (SEQ ID NO: 32), or UGGGCCCAUGCCCCUGAUGCU (SEQ ID NO: 35).
  2. The antisense oligonucleotide for use according to of claim 1, wherein the target region is comprised within the sequence CUAAUGGCACUGACUCAGCCUUCCAUGUGCUUGCUAAGC (SEQ ID NO: 9), CUAAUGGCACUGACUCAGCCU (SEQ.ID NO: 44), or CCUGUGCGUGAAACCAACCCU (SEQ ID NO: 31).
  3. The antisense oligonucleotide for use according to claim 1 or claim 2, wherein the proliferative disease is a disease in which the numb protein acts as an antitumor agent.
  4. The antisense oligonucleotide for use according to claim 3, wherein the disease or condition is lung adenocarcinoma, non-small cell lung cancer, lung small cell carcinoma, lung squamous cell carcinoma, cervical cancer, breast cancer, pancreatic cancer, prostate cancer, hepatocacinoma, osteosarcoma, neuroblastoma or colon cancer, and/or wherein the antisense oligonucleotide is for use in a method for the treatment of a subject in need thereof, wherein the method comprises administering the oligonucleotide or a composition comprising the oligonucleotide to the subject; optionally wherein the method further comprises testing a tissue sample obtained from the subject for elevated levels of exon 9 inclusion compared to a healthy control.
  5. The antisense oligonucleotide for use according to claim 4, wherein the subject has a cancer or tumour and the method comprises delivering the oligonucleotide to the site of the cancer or the tumour.
  6. The antisense oligonucleotide for use according to claim 5, wherein the subject has lung cancer and the method comprises delivering the oligonucleotide through the respiratory system.
  7. The antisense oligonucleotide for use according to any of claims 4 to 6, wherein the method comprises injecting a composition comprising the oligonucleotide intravenously.
  8. The antisense oligonucleotide for use according to any of claims 1 to 7, wherein: the antisense oligonucleotide comprises a nucleotide sequence that is complementary to a target region comprising at least 13 nucleotides of NUMB exon 9, wherein the target region is comprised within the sequence of SEQ ID NO. 305, 10, 32, 35, 9, 44 or 31; and/or wherein the oligonucleotide is between 7 and 31 nucleotides long; and/or wherein the antisense oligonucleotide comprises a nucleotide sequence that is complementary to a target region of between 7 and 25 nucleotides of NUMB exon 9, wherein the target region is comprised within the sequence of SEQ ID NO. 305, 10, 32, 35, 9, 44 or 31.
  9. The antisense oligonucleotide for use according to any of claims 1 to 8, which is between 7 and 15 nucleotides long, and wherein the oligonucleotide is a locked nucleic acid; which is between 18 and 25 nucleotides long, and wherein the oligonucleotide is a 2'-O-methyl phosphorothioate ribonucleic acid; or which is between 18 and 25 nucleotides long, and wherein the oligonucleotide is a 2'-O-methoxyethyl-modified phosphorothioate ribonucleic acid.
  10. The antisense oligonucleotide for use according to any of claims 1 to 9, wherein the oligonucleotide comprises a sequence selected from: AGGCUGA (SEQ ID NO: 36), GUCAGUG (SEQ ID NO: 37), CCAUUAG (SEQ ID NO: 38), CUGAGUC (SEQ ID NO: 39), or AGUGCCA (SEQ ID NO: 40); and/or, wherein the oligonucleotide comprises a sequence selected from: AGGCUGAGUCAGUG (SEQ ID NO: 41), or GUCAGUGCCAUUAG (SEQ ID NO: 42); and/or, wherein the oligonucleotide comprises a sequence selected from: AGGCUGAGUCAGUGCCAUUAG (SEQ ID NO: 43) or AGGCUGAGUCAGUGCCAUUAG (SEQ ID NO: 12); and/or wherein the oligonucleotide comprises a sequence selected from: AGGGUUGGUUUCACGCACAGG (SEQ ID NO: 22) or GGCUGCAAUUUCCUUGUUAGC (SEQ ID NO: 24).
  11. The antisense oligonucleotide for use according to any of claims 1 to 10, wherein the oligonucleotide comprises a sequence selected from CACAUGGAAGGCUGAGUCAGU (SEQ ID NO: 19); GCUUAGCAAGCACAUGGAAGG (SEQ ID NO: 13); and AGUAUGGGCUGGCUUAGCAAG (SEQ ID NO: 20).
  12. An antisense oligonucleotide for reducing inclusion of NUMB exon 9 in a population of mature NUMB transcripts: i) the antisense oligonucleotide comprising a sequence of 19 nucleotides that is fully complementary to a target region of a NUMB transcript; wherein the target region is comprised within: the sequence CUAAUGGCACUGACUCAGCCU (SEQ.ID NO: 44); or the sequence GCUAACAAGGAAAUUGCAGCC (SEQ ID NO: 32); or the sequence AAACCAACCCUUGGGCCCAUG (SEQ ID NO: 6); or ii) the antisense oligonucleotide comprising a sequence of 20 nucleotides that is fully complementary to a target region of a NUMB transcript; wherein the target region is comprised within: the sequence CCGUAGCAAUGCCUGUGCGUGAAACCAACCCUUGGGCCCAUG (SEQ ID NO: 10); or the sequence CUAAUGGCACUGACUCAGCCU (SEQ.ID NO: 44); or the sequence CCUGUGCGUGAAACCAACCCU (SEQ ID NO: 31); or the sequence GCUAACAAGGAAAUUGCAGCC (SEQ ID NO: 32); or the sequence CCGUAGCAAUGCCUGUGCGUG (SEQ ID NO: 5); or the sequence AAACCAACCCUUGGGCCCAUG (SEQ ID NO: 6); or the sequence UGGGCCCAUGCCCCUGAUGCU (SEQ ID NO: 35); or the sequence CUAAUGGCACUGACUCAGCCUUCCAUGUGCUUGCUAAGCCAGCCCAUACU (SEQ ID NO: 305); or the sequence CUAAUGGCACUGACUCAGCCUUCCAUGUGCUUGCUAAGC (SEQ ID NO: 9); or iii) the antisense oligonucleotide comprising a sequence of at least 21 nucleotides that is fully complementary to a target region of a NUMB transcript; wherein the target region is comprised within: the sequence CCGUAGCAAUGCCUGUGCGUGAAACCAACCCUUGGGCCCAUG (SEQ ID NO: 10); or the sequence CUAAUGGCACUGACUCAGCCU (SEQ.ID NO: 44); or the sequence CCUGUGCGUGAAACCAACCCU (SEQ ID NO: 31); or the sequence GCUAACAAGGAAAUUGCAGCC (SEQ ID NO: 32); or the sequence CCGUAGCAAUGCCUGUGCGUG (SEQ ID NO: 5); or the sequence AAACCAACCCUUGGGCCCAUG (SEQ ID NO: 6); or the sequence UGGGCCCAUGCCCCUGAUGCU (SEQ ID NO: 35); or the sequence CUAAUGGCACUGACUCAGCCUUCCAUGUGCUUGCUAAGCCAGCCCAUACU (SEQ ID NO: 305); or the sequence CUAAUGGCACUGACUCAGCCUUCCAUGUGCUUGCUAAGC (SEQ ID NO: 9).
  13. The antisense oligonucleotide of claim 12, or the antisense oligonucleotide for use according to any of claims 1 to 11, which essentially consists of a nucleotide sequence complementary to a contiguous nucleotide sequence of a NUMB transcript.
  14. The antisense oligonucleotide of claims 12 or 13, or the antisense oligonucleotide for use according to any of claims 1 to 11 or 13, wherein the oligonucleotide is an RNA or modified RNA molecule, a DNA or motified DNA molecule, or a mixture of native or modified RNA and native or modified DNA.
  15. The antisense oligonucleotide of any of claims 12 to 14, or the antisense oligonucleotide for use according to any of claims 1 to 11, 13 or 14, wherein at least one cytosine residue within the oligonucleotide is methylated.
  16. A pharmaceutical composition comprising one or more antisense oligonucleotides according to claims 12 to 15, optionally further comprising one or more excipients.

Description

Field of the Invention This invention relates to antisense nucleotides that promote the exclusion of NUMB exon 9. In particular, the invention relates to oligonucleotides comprising a sequence that is complementary to a target region of a NUMB transcript, the target region being comprised in exon 9. The oligonucleotides of the invention are particularly useful in the treatment of proliferative diseases. Background of the Invention Alternative splicing is a major regulatory mechanism in eukaryotic gene expression, and its alterations have been linked with various diseases. For example, increased inclusion of a specific exon (exon 9) within the Open Reading Frame of a protein called NUMB has been reported as one of the most common splicing alterations in lung cancer (Misquitta-Ali et al. 2011; Sebestyén et al., 2015). Increased NUMB exon 9 inclusion has further been shown to increase the proliferative capacity of cancer cells in vitro (Bechara et al., 2013). The NUMB protein is known to play a role in regulation of at least the Notch pathway: isoforms of NUMB that exclude exon 9 act as repressors of the pathway and of cell proliferation, whereas isoforms of NUMB including exon 9 correlate with reduced NUMB protein levels and activation of the NOTCH pathway (Misquitta-Ali et al., 2011; Westhoff et al., 2009). Because of the known correlation between NUMB alternative splicing of exon 9 and cell proliferation, as well as data indicating that increased NUMB exon 9 inclusion is amongst the most frequent tumour-associated alternative splicing changes that have been observed in lung cancer, the alternative splicing of exon 9 of NUMB represents a potential target for therapy. However, although some studies of alternative splicing have been conducted (see Bechara et al., 2013), the mechanisms involved are poorly understood and there is still a need for new and more effective ways of promoting the skipping of exon 9 in the NUMB pre-mRNA splicing process. One potential strategy for regulating alternative splicing is the use of antisense oligonucleotides (AONs). AONs are short synthetic nucleotides which can bind to a complementary target sequence. Therapies based on AONs have been developed and an AON that targets an intronic splicing enhancer site of the pre-mRNA corresponding to the protein SMN2 (resulting in increased inclusion of exon 7), has been approved by the FDA and the EMA for the treatment of spinal muscular atrophy (Hua et al., 2010; Hua et al., 2011). However, efficient regulation of exon 9 inclusion / exclusion in NUMB has not been achieved using AONs or other methods. EP 2 311 530 A2 relates generally to cellular genes that are necessary for viral growth in a cell but which are not essential for the cell to survive, and their potential for modulation to treat viral infections. The present invention seeks to provide compounds that can efficiently regulate NUMB alternative splicing. Summary of the Invention In general terms, the present invention provides new compounds comprising oligonucleotides capable of regulating the alternative splicing of exon 9 of NUMB. Described is an antisense oligonucleotide for reducing inclusion of NUMB exon 9 in a population of mature NUMB transcripts, the antisense oligonucleotide comprising a sequence of at least 7 nucleotides that is complementary to a target region within exon 9 (SEQ ID NO: 2 or homologues thereof) of a NUMB transcript. Also described is an antisense oligonucleotide for reducing inclusion of NUMB exon 9 in a population of NUMB mRNAs, the antisense oligonucleotide comprising a sequence of at least 7 nucleotides that is complementary to a target region within exon 9 (SEQ ID NO: 2 or homologues thereof) of a NUMB pre-mRNA. Further described is an antisense oligonucleotide is disclosed comprising a sequence of at least 7 nucleotides that is complementary to a target region of a NUMB transcript, wherein the target region comprises at least 7 nucleotides and is comprised in exon 9 (SEQ ID NO: 2) or homologues thereof, and wherein, in use, the oligonucleotide reduces inclusion of exon 9 in the mature NUMB transcript. There is also described an oligonucleotide comprising 7 consecutive nucleotides of SEQ ID NO: 12, 22 or 24, wherein the oligonucleotide binds to a target region of a NUMB transcript which is comprised within NUMB exon 9, and wherein, in use, the oligonucleotide reduces inclusion of exon 9 in the mature NUMB transcript. According to an aspect of the invention, there is provided an antisense oligonucleotide for reducing inclusion of NUMB exon 9 in a population of mature NUMB transcripts for use in the treatment of a proliferative disease, such as a tumour or a cancer, the antisense oligonucleotide comprising a sequence of at least 7 nucleotides that is complementary to a target region within exon 9 (SEQ ID NO: 2) of a NUMB transcript; wherein the target region is comprised within the sequence,CUAAUGGCACUGACUCAGCCUUCCAUGUGCUUGCUAAGCCAGCCCAUACU (SEQ ID N