Search

EP-4739802-A1 - METHODS AND MEANS FOR DETECTION OF LEGIONELLA

EP4739802A1EP 4739802 A1EP4739802 A1EP 4739802A1EP-4739802-A1

Abstract

The invention relates to methods for determining whether a sample comprises Legionella pneumophila, the method comprising performing an isothermal nucleic acid amplification (iNAAT) reaction with said sample with a primer set specific for the Legionella pneumophila DotB or MIP gene and determining whether the sample comprises an amplification product of the amplification reaction. The invention further relates to primer sets specific for the Legionella pneumophila DotB or MIP gene that are useful in such method, and kits of part comprising such primer set.

Inventors

  • VAN DER WURFF, Michelle
  • KEIJSER, BART JAN FREDERIK
  • Kieboom, Jasper
  • DEKKER, Floris Anthonie Jan
  • VERMEULEN, Kim

Assignees

  • Nederlandse Organisatie voor Toegepast-Natuurwetenschappelijk Onderzoek TNO

Dates

Publication Date
20260513
Application Date
20240704

Claims (20)

  1. Claims 1. A method for determining whether a sample comprises Legionella pneumophila, the method comprising performing an isothermal nucleic acid amplification (iNAAT) reaction with said sample with a primer set specific for the Legionella pneumophila DotB gene and determining whether the sample comprises an amplification product of the amplification reaction.
  2. 2. A method of detecting an amplification product in a sample, the method comprising performing an isothermal nucleic acid amplification (iNAAT) reaction with said sample with a primer set specific for the Legionella pneumophila DotB gene and determining whether the sample comprises an amplification product of the amplification reaction.
  3. 3. The method according to claim 1 or 2, wherein said isothermal nucleic acid amplification reaction is a loop-mediated isothermal amplification (LAMP) reaction.
  4. 4. The method according to any one of the preceding claims wherein said amplification reaction is performed with a primer set specific for a region of the DotB gene consisting of nucleotides 567-1134 or 562-1134 as depicted in figure 1, preferably consisting of nucleotides 562-1109 as depicted in figure 1.
  5. 5. The method according to any one claims 1-4 wherein said amplification reaction is performed with a LAMP primer set comprising a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP) and a backward inner primer (BIP), and optionally further comprising a loop forward primer (LoopF) and/or loop backward primer (LoopB), preferably at least one Loop primer, more preferably a LoopF primer, and wherein: ^ primer F3 comprises a consecutive stretch of at least 15 nucleotides of the sequence ATACTTCTGGTGTTGCAGAAA; ^ primer B3 comprises a consecutive stretch of at least 15 nucleotides of the sequence CACTTCGTTAGGGTCTCC; ^ primer FIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence AATGCAAAGCCTAATTGTTTCAAGATCTTTTAGCGGGGAAGAG; ^ primer BIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence TGGTCCCAACCGTTGATGAAAGCTCCAATAGAATATCTCTCACTTC, and optionally ^ primer LoopF comprises a consecutive stretch of at least 15 nucleotides of the sequence ATCGATGGTTCTTCCCAAACG.
  6. 6. The method according to any one of claims 1-5 wherein: ^ primer F3 comprises the sequence ATACTTCTGGTGTTGCAGAAA; ^ primer B3 comprises the sequence CACTTCGTTAGGGTCTCC; ^ primer FIP comprises the sequence AATGCAAAGCCTAATTGTTTCAAGATCTTTTAGCGGGGAAGAG; ^ primer BIP comprises the sequence TGGTCCCAACCGTTGATGAAAGCTCCAATAGAATATCTCTCACTTC, and optionally ^ primer LoopF comprises the sequence ATCGATGGTTCTTCCCAAACG.
  7. 7. The method according to any one claims 1-4 wherein said amplification reaction is performed with a LAMP primer set comprising a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP) and a backward inner primer (BIP), and optionally further comprising a loop forward primer (LoopF) and/or loop backward primer (LoopB), preferably at least one Loop primer, more preferably a LoopB primer, and wherein: ^ primer F3 comprises a consecutive stretch of at least 15 nucleotides of the sequence ACCCAACTTTGCTGATGGAG; ^ primer B3 comprises a consecutive stretch of at least 15 nucleotides of the sequence CCCGCTAAAAGATGTGACCA; ^ primer FIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence CGGCACTGATGGTTTCTGCATCACGCATTAAGACGAAAGCCA; ^ primer BIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence CTTGAAGCCGCTTTAACAGGGCGCATTGTTTCTGCAACACCA, and optionally ^ primer LoopB comprises a consecutive stretch of at least 15 nucleotides of the sequence ACCCTGTCTACACAACCCTGCA.
  8. 8. The method according to any one of claims 1-4 or 7 wherein: ^ primer F3 comprises the sequence ACCCAACTTTGCTGATGGAG; ^ primer B3 comprises the sequence CCCGCTAAAAGATGTGACCA; ^ primer FIP comprises the sequence CGGCACTGATGGTTTCTGCATCACGCATTAAGACGAAAGCCA; ^ primer BIP comprises the sequence CTTGAAGCCGCTTTAACAGGGCGCATTGTTTCTGCAACACCA, and optionally ^ primer LoopB comprises the sequence ACCCTGTCTACACAACCCTGCA.
  9. 9. The method according to any one claims 1-4 wherein said amplification reaction is performed with a LAMP primer set comprising a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP) and a backward inner primer (BIP), and optionally further comprising a loop forward primer (LoopF) and/or loop backward primer (LoopB), preferably at least one Loop primer, more preferably a LoopB primer, and wherein: ^ primer F3 comprises a consecutive stretch of at least 15 nucleotides of the sequence TCTGGTATTCGATGAAGAAGT; ^ primer B3 comprises a consecutive stretch of at least 15 nucleotides of the sequence TGATATTCTTTGGCCCCAG; ^ primer FIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence CTCACTAACTTACGAGTGGCTGGAGAGATATTCTATTGGAGGGA; ^ primer BIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence GCAAAAAGGGCAGTTAATGACTTCTCGCTCACTGATAATCCC, and optionally ^ primer LoopB comprises a consecutive stretch of at least 15 nucleotides of the sequence GGGACGCAAAAATGAAATTTGAAC.
  10. 10. The method according to any one of claims 1-4 or 9 wherein: ^ primer F3 comprises the sequence TCTGGTATTCGATGAAGAAGT; ^ primer B3 comprises the sequence TGATATTCTTTGGCCCCAG; ^ primer FIP comprises the sequence CTCACTAACTTACGAGTGGCTGGAGAGATATTCTATTGGAGGGA; ^ primer BIP comprises the sequence GCAAAAAGGGCAGTTAATGACTTCTCGCTCACTGATAATCCC, and optionally ^ primer LoopB comprises the sequence GGGACGCAAAAATGAAATTTGAAC.
  11. 11. The method according to any one claims 1-4 wherein said amplification reaction is performed with a LAMP primer set comprising a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP) and a backward inner primer (BIP), and optionally further comprising a loop forward primer (LoopF) and/or loop backward primer (LoopB), preferably at least one Loop primer, more preferably a LoopB primer, and wherein: ^ primer F3 comprises a consecutive stretch of at least 15 nucleotides of the sequence TCCCCGATAGAATTCGTCTA; ^ primer B3 comprises a consecutive stretch of at least 15 nucleotides of the sequence ATGCAGGGTTGTGTAGAC; ^ primer FIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence TCAGCAAAGTTGGGTAAGTGTCTTAAATTGAAACAATTTCCGCTGTA; ^ primer BIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence CGAAAGCCAAGATTAATTATGGTGGGTTAAAGCGGCTTCAAGAG, and optionally ^ primer LoopB comprises a consecutive stretch of at least 15 nucleotides of the sequence GTGAATGTCGTGATGCAGAAACC.
  12. 12. The method according to any one of claims 1-4 or 11 wherein: ^ primer F3 comprises the sequence TCCCCGATAGAATTCGTCTA; ^ primer B3 comprises the sequence ATGCAGGGTTGTGTAGAC; ^ primer FIP comprises the sequence TCAGCAAAGTTGGGTAAGTGTCTTAAATTGAAACAATTTCCGCTGTA; ^ primer BIP comprises the sequence CGAAAGCCAAGATTAATTATGGTGGGTTAAAGCGGCTTCAAGAG, and optionally ^ primer LoopB comprises the sequence GTGAATGTCGTGATGCAGAAACC.
  13. 13. The method according to any one claims 1-4 wherein said amplification reaction is performed with a LAMP primer set comprising a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP) and a backward inner primer (BIP), and optionally further comprising a loop forward primer (LoopF) and/or loop backward primer (LoopB), preferably at least one Loop primer, and wherein: ^ primer F3 comprises a consecutive stretch of at least 15 nucleotides of the sequence CAATTTCCGCTGTAGTAAGC; ^ primer B3 comprises a consecutive stretch of at least 15 nucleotides of the sequence CGCATTGTTTCTGCAACAC; ^ primer FIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence CTTGGCTTTCGTCTTAATGCGTTTCAATCAGAGATTCCAAGACAC; ^ primer BIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence TATGGTGGGTGAATGTCGTGAGTTGTGTAGACAGGGTGC, and optionally ^ primer LoopF comprises a consecutive stretch of at least 15 nucleotides of the sequence CTCCATCAGCAAAGTTGGGTAA and/or ^ Primer LoopB comprises a consecutive stretch of at least 15 nucleotides of the sequence TGCAGAAACCATCAGTGCC
  14. 14. The method according to any one of claims 1-4 or 13 wherein: ^ primer F3 comprises the sequence CAATTTCCGCTGTAGTAAGC; ^ primer B3 comprises the sequence CGCATTGTTTCTGCAACAC; ^ primer FIP comprises the sequence CTTGGCTTTCGTCTTAATGCGTTTCAATCAGAGATTCCAAGACAC; ^ primer BIP comprises the sequence TATGGTGGGTGAATGTCGTGAGTTGTGTAGACAGGGTGC, and optionally ^ primer LoopF comprises the sequence CTCCATCAGCAAAGTTGGGTAA, and/or ^ Primer LoopB comprises the sequence TGCAGAAACCATCAGTGCC
  15. 15. A method for determining whether a sample comprises Legionella pneumophila, the method comprising performing an isothermal nucleic acid amplification (iNAAT) reaction with said sample with a primer set specific for the Legionella pneumophila MIP gene, wherein said primer set comprises a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP) and a backward inner primer (BIP), and optionally further comprising a loop forward primer (LoopF) and/or loop backward primer (LoopB), preferably at least one Loop primer, more preferably a LoopB primer, and determining whether the sample comprises an amplification product of the amplification reaction, wherein: - primer F3 comprises a consecutive stretch of at least 15 nucleotides of the sequence CAAAGTAATCAATTCTGGAAATGG; - primer B3 comprises a consecutive stretch of at least 15 nucleotides of the sequence ACATAAATTTCCCAAGTTGATCC; - primer FIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence GTACCATCAATCAGACGACCAGGTTAAACCCGGAAAATCGGA; - primer BIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence CCGAAAAAACTGGTAAGCCAGCTGGCATCAATTGCAAAGC, and optionally - primer LoopB comprises a consecutive stretch of at least 15 nucleotides of the sequence CAAGTTATCCCTGGATGGACAGAA.
  16. 16. A method of detecting an amplification product in a sample, the method comprising performing an isothermal nucleic acid amplification (iNAAT) reaction with said sample with a primer set specific for the Legionella pneumophila MIP gene, wherein said primer set comprises a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP) and a backward inner primer (BIP), and optionally further comprising a loop forward primer (LoopF) and/or loop backward primer (LoopB), preferably at least one Loop primer, more preferably a LoopB primer, and determining whether the sample comprises an amplification product of the amplification reaction, wherein - primer F3 comprises a consecutive stretch of at least 15 nucleotides of the sequence CAAAGTAATCAATTCTGGAAATGG; - primer B3 comprises a consecutive stretch of at least 15 nucleotides of the sequence ACATAAATTTCCCAAGTTGATCC; - primer FIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence GTACCATCAATCAGACGACCAGGTTAAACCCGGAAAATCGGA; - primer BIP comprises a consecutive stretch of at least 30 nucleotides or two consecutive stretches of at least 30 nucleotides in total of the sequence CCGAAAAAACTGGTAAGCCAGCTGGCATCAATTGCAAAGC, and optionally - primer LoopB comprises a consecutive stretch of at least 15 nucleotides of the sequence CAAGTTATCCCTGGATGGACAGAA.
  17. 17. The method according to any one claims 1-14, further comprising performing an isothermal nucleic acid amplification (iNAAT) reaction with said sample with a primer set specific for the L. pneumophila MIP gene as defined in claim 15.
  18. 18. The method according to any one of the preceding claims wherein the sample is an environmental sample or a biological sample, in particular a sample obtained from an individual.
  19. 19. A loop-mediated isothermal amplification (LAMP) primer set specific for Legionella pneumophila DotB gene, the primer set comprising a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP) and a backward inner primer (BIP), and optionally a loop forward primer (LoopF) and/or loop backward primer (LoopB), preferably at least one Loop primer.
  20. 20. The LAMP primer set according to claim 19 wherein said primer set is specific for a region of the DotB gene consisting of nucleotides 567-1134 or 562- 1134 as depicted in figure 1, preferably consisting of nucleotides 562-1109 as depicted in figure 1.

Description

P132862PC00 Title: Methods and means for detection of Legionella Field of the invention The invention relates to methods, primers and kits for the detection of Legionella spp, in particular Legionella pneumophila, in particular for isothermal nucleic acid amplification (iNAAT) based detection thereof. Background of the invention Legionella bacteria are rod-shaped non-spore forming bacteria that are ubiquitous in water and soil. The genus holds 60 known species, and although several Legionella species have been associated with human infection, Legionella pneumophila is the prime cause of Legionnaire's disease and the most common cause of Pontiac fever. The bacteria can grow in warm, stagnant water systems such as those in cooling towers, water distribution systems within public buildings, households and industrial facilities and hydric pipelines in hospitals. The main route for transmission is through inhalation of small droplets (aerosols), posing a health risk for the population. The risk associated with Legionella pneumophila is exemplified by regular deadly outbreaks. Legislation for proper control of legionella is in place to safeguard risks in many countries. This typically involves technical measures for prevention and bi- annual surveillances for risk environments (e.g. hotels, hospitals, camp sites and swimming pools) by legionella testing. In clinical practice, Legionella pneumophila testing is relevant for the correct diagnosis of disease. Legionella testing is performed both on clinical samples as well as on environmental (in particular water) samples. Diagnostic practices include bacterial culture, serological and antibody-based assays, nucleic acid detection systems (e.g., polymerase chain reaction) and urine antigen tests. Current testing methods rely both on cultivation as well as on PCR-based molecular detection. In the clinic, also antigen and antibody based testing is performed, reflecting the immune response of the patient to a previous Legionella infection. Cultivation-dependent analysis takes between 10-14 days, molecular testing requires 24-72 hours. While PCR is relatively rapid, providing results in approximately 1-3 hours, shipment to a molecular microbiology laboratory and sample handling delays provision of results. The current gold standard in molecular detection of Legionella involves the detection of the MIP gene, which is specific to Legionella pneumophila, and the 16S rRNA gene, which is used for identifying the Legionella genus. Loop mediated isothermal amplification (LAMP), which allows on-site analysis, has been deployed for the detection of Legionella spp and Legionella pneumophila. EP3187595 describes a method for LAMP designed to amplify specifically sequences of Legionella 's 16S ribosomal RNA (rRNA) gene using a set of specially designed LAMP primers. CN106755302A describes a LAMP primer set for the DotA gene of Legionella pneumophila. CN105483211A describes a nested LAMP primer set for Legionella pneumophila detection primers specific for the MIP gene. There is a need in the art to provide further Legionella detection methods which further enhance the speed, ease, sensitivity and/or broad taxonomic coverage of Legionella detection. Summary of the invention It is an object of the present invention to provide reliable, sensitive and fast Legionella detection. The invention therefore provides a method for determining whether a sample comprises Legionella pneumophila, the method comprising performing an isothermal nucleic acid amplification (iNAAT) reaction with said sample with a primer set specific for the Legionella pneumophila DotB gene and determining whether the sample comprises an amplification product of the amplification reaction. In a further aspect, the invention provides a method of detecting an amplification product in a sample, the method comprising performing an isothermal nucleic acid amplification (iNAAT) reaction with said sample with a primer set specific for the Legionella pneumophila DotB gene and determining whether the sample comprises an amplification product of the amplification reaction. In a further aspect, the invention provides a method for determining whether a sample comprises Legionella pneumophila, the method comprising performing an isothermal nucleic acid amplification (iNAAT) reaction with said sample with a primer set specific for the Legionella pneumophila MIP gene, wherein said primer set comprises a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP) and a backward inner primer (BIP), and optionally further comprising a loop forward primer (LoopF) and/or loop backward primer (LoopB), preferably at least one Loop primer, preferably a LoopB primer, and determining whether the sample comprises an amplification product of the amplification reaction, wherein: - primer F3 comprises a consecutive stretch of at least 15 nucleotides of the sequence CAAAGTAATCAATTCTGGAAATGG; - primer B3 comprises a cons