Search

EP-4741502-A1 - DSRNA MOLECULE FOR INHIBITING LP(A) GENE EXPRESSION AND USE THEREOF

EP4741502A1EP 4741502 A1EP4741502 A1EP 4741502A1EP-4741502-A1

Abstract

Disclosed are a modified dsRNA molecule and a use thereof. Specifically, provided is a dsRNA molecule for inhibiting LP(a) gene expression, comprising a sense strand and an antisense strand complementary to form a double-stranded region, wherein the sense strand and/or the antisense strand comprises 15-25 nucleotides or consists of 15-25 nucleotides. The dsRNA molecule can be used for treating and/or preventing LP(a) gene-mediated diseases.

Inventors

  • CHEN, Huiyu
  • WANG, LINGYU
  • SU, Xiaoye
  • REN, Jiafeng
  • SHAO, YU
  • ZHONG, Qiang

Assignees

  • CSPC Zhongqi Pharmaceutical Technology (Shijiazhuang) Co., Ltd.

Dates

Publication Date
20260513
Application Date
20240703

Claims (13)

  1. A dsRNA molecule for inhibiting Lp(a) gene expression, comprising a sense strand and an antisense strand that are complementary to each other to form a double-stranded region, wherein the sense strand and the antisense strand each comprise or consist of 15-25 nucleotides, and the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of a sense strand sequence shown in Table 2, and the double-stranded region is 15-25bp in length; optionally, wherein at least one nucleotide in the dsRNA molecule is modified.
  2. The dsRNA molecule according to claim 1, characterized in that the nucleotide sequence of the sense strand and the nucleotide sequence of the antisense strand are selected from the sense strand and antisense strand sequences shown in Table 2.
  3. The dsRNA molecule according to claim 1 or 2, characterized in that the modification is selected from any one or more of the following: locked nucleic acid modification, open ring or non-locked nucleic acid modification, 2'-methoxyethyl modification, 2'-O-methyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-fluoro modification, 2'-deoxy modification, 2'-hydroxyl modification, phosphorothioate backbone modification, DNA modification, fluorescent probe modification, and ligand modification.
  4. The dsRNA molecule according to claim 3, characterized in that the modification patterns of the dsRNA molecule include: (1) sense strand: 17-21nt, preferably 21nt in length; composed of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, each modified region being 1 to 10 nucleotides in length; the modification patterns of the first modified region from the 5' end and that from the 3' end being the same; and the consecutive nucleotide regions from the 1st to the 3rd position from the 5' end being ligated by phosphorothioate backbones; (2)antisense strand: 19-23nt, preferably 23nt in length; composed of alternating 2'-O-methyl modified regions, 2'-fluoro modified regions, unmodified regions or DNA regions, each modified region being 1-11 nucleotides in length; and the consecutive nucleotide regions from the 1st to the 3rd position from the 5' end and the consecutive nucleotide regions from the 1st to the 3rd position from the 3 ' end all being ligated by phosphorothioate backbones.
  5. The dsRNA molecule according to claim 1, characterized in that the base sequences of the sense strand and the antisense strand of the dsRNA molecule are or comprise sequences selected from any one of the following groups: 1) sense strand: CAGAGUUAUCGAGGCACAUUC (SEQ ID NO:709), antisense strand: GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO:710); 2) sense strand: AGAGUUAUCGAGGCACGUACU (SEQ ID NO:485), antisense strand: AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO:486); 3) sense strand: GAGGCACGUACUCCACCACUG (SEQ ID NO:491), antisense strand: CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO:492); 4) sense strand: AGUUAUCGAGGCACAUACUCC(SEQ ID NO:531), antisense strand: GGAGUAUGUGCCUCGAUAACUCU(SEQ ID NO:532); and 5) sense strand: CUGCCAAGCUUGGUCAUCUAU (SEQ ID NO:119), antisense strand: AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO:120).
  6. The dsRNA molecule according to claim 1, wherein the sequences of the sense strand and the antisense strand of the dsRNA comprise or are selected from any one of the following groups: 1) sense strand: CmsAmsGmAmGmUmUfAmUfCfGfAmGmGmCmAmCmAmUmUmCm (SEQ ID NO:9), antisense strand: GmsAfsAmUmGmUmGmCmCmUmCmGmAmUfAmAfCmUmCmUmGmsGmsCm (SEQ ID NO:10); 2) sense strand: AmsGmsAmGmUmUmAfUmCfGfAfGmGmCmAmCmGmUmAmCmUm (SEQ ID NO:1) antisense strand: AmsGfsUmAmCmGmUmGmCmCmUmCmGmAfUmAfAmCmUmCmUmsGmsUm (SEQ ID NO:2) 3) sense strand: GmsAmsGmGmCmAmCfGmUfAfCfUmCmCmAmCmCmAmCmUmGm (SEQ ID NO:3) antisense strand: CmsAfsGmUmGmGmUmGmGmAmGmUmAmCfGmUfGmCmCmUmCmsGmsAm (SEQ ID NO:4) 4) sense strand: AmsGmsUmUmAmUmCfGmAfGfGfCmAmCmAmUmAmCmUmCmCm (SEQ ID NO:5) antisense strand: GmsGfsAmGmUmAmUmGmUmGmCmCmUmCfGmAfUmAmAmCmUmsCmsUm (SEQ ID NO:6); and 5) sense strand: CmsUmsGmCmCmAmAfGmCfUfUfGmGmUmCmAmUmCmUmAmUm (SEQ ID NO:7) antisense strand: AmsUfsAmGmAmUmGmAmCmCmAmAmGmCfUmUfGmGmCmAmGmsGmsUm (SEQ ID NO:8); wherein Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G respectively; Af, Uf, Cf and Gf represent 2'-fluoro-modified ribonucleotides A, U, C and G respectively; s indicates that the preceding and the posterior nucleotides are ligated by a phosphorothioate backbone.
  7. The dsRNA molecule according to claim 6, further comprising at least one asialoglycoprotein receptor (ASGPR) ligand.
  8. The dsRNA molecule according to claim 7, wherein the ligand is linked to a 5'-terminal or 3'-terminal nucleotide of the nucleotide sequence of the sense strand or antisense strand of the dsRNA through a phosphodiester bond or a phosphorothioate bond.
  9. The dsRNA molecule according to any one of claims 1 to 8, wherein the ASGPR ligand is one or more GalNAc derivatives linked by a divalent or trivalent branched structure.
  10. The dsRNA molecule according to claim 9, wherein the GalNAc derivative is inked by a trivalent branched structure comprising the following structure:
  11. The dsRNA molecule according to claim 10, wherein the GalNac derivative is L96, and the structure of L96 is as follows:
  12. The dsRNA molecule according to claim 11, wherein the L96 is linked to a 3' terminal nucleotide of the nucleotide sequence of the sense strand of the dsRNA through a phosphodiester bond or a phosphorothioate bond; and the structure of the L96 and its linkage mode to the nucleotide sequence of the sense strand are as follows:
  13. A use of a dsRNA, selected from any one of the following groups: (I) Use of the dsRNA molecule according to any one of claims 1 to 12 in inhibiting Lp(a) gene expression or in preparing a product for inhibiting Lp(a) gene expression; (II) Use of the dsRNA molecule of any one of claims 1 to 12 in a product for reducing the level of Lp(a) particles; (III) Use of the dsRNA molecule of any one of claims 1 to 12 for preventing and/or treating a condition, pathology or syndrome associated with an elevated level of Lp(a) particles, or for the preparation of a product for preventing and/or treating a condition, pathology or syndrome associated with an elevated level of Lp(a) particles; preferably, the disease associated with an elevated level of Lp(a) particles is selected from any one or more of the following: stroke, atherosclerosis, thrombosis, cardiovascular disease, and aortic valve stenosis.

Description

Field The present application belongs to the field of molecular biology and relates to a modified dsRNA molecule and a use thereof, and specifically to a dsRNA molecule for inhibiting the expression of LP(a) gene and a pharmaceutical composition thereof, as well as a method for reducing the expression level of LP(a) gene using the dsRNA molecule or the pharmaceutical composition thereof. Background RNA interference (RNAi) refers to the phenomenon of highly conserved, highly efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA) during evolution. RNAi is a monitoring mechanism commonly found in eukaryotes to resist viral invasion, inhibit transposon activity, and regulate gene expression. Small interfering RNA (siRNA) is a type of short double-stranded RNA molecule with a length of 19 to 30 and is one of the important tools in RNAi technology. In natural organisms, after dsRNA enters the cell, it will be specifically recognized by the Dicer enzyme and cut into small RNA fragments of 21 to 23 nucleotides in length (i.e., siRNA). The dsRNA fragments produced by the cutting are unwound into single strands and form complexes with certain proteins (referred to as RISC). RISC can bind to the mRNA complementary to dsRNAs in the cell and cut the mRNA to degrade it, resulting in the inability to synthesize proteins and produce a "silencing" phenomenon of genes. In industrial production, people prefer to chemically synthesize dsRNA and modify it to further improve the stability and effectiveness of dsRNA drugs. In recent years, breakthroughs have been made in the research of dsRNA drugs. Many dsRNA drugs for rare diseases have been approved by the FDA, such as patisiran (for the treatment of hereditary transthyretin amyloidosis), eteplirsen (Duchenne muscular dystrophy), givosiran (acute intermittent porphyria), spinraza (spinal muscular atrophy), etc. The treatment field of dsRNA drugs has gradually expanded from rare diseases to common diseases. For example, inclisiran, which has just been approved for the treatment of hyperlipidemia, DCRHBVS, which is used to treat hepatitis B, tivanisiran (dry eye syndrome), QPI-1007 (optic atrophy), SYL040012 (glaucoma), QPI-1002, which is used to treat severe kidney disease, etc. The continuous deepening of clinical research on dsRNA drugs and their successful marketing have made the development path of dsRNA drugs gradually clear. With their unique gene silencing ability, they have cured more and more diseases and brought good news to all mankind. Lipoprotein A (Lp(a)) particles are essentially low-density lipoprotein-like particles, consisting of apolipoprotein A linked to LDL-like particles by the ApoB polypeptide. They are synthesized in the liver from independent triglycerides and are not affected by age or diet. High level of Lp(a) can lead to atherosclerosis and it has been found in the walls of arteries. Because its structure is similar to that of plasminogen, it can also inhibit fibrinolysis, thus forming blood clots; high serum levels of Lp(a) are associated with premature atherosclerosis and stroke. Serum concentrations of Lp(a) are mainly related to genetics and are basically unaffected by sex, age, weight, and most cholesterol-lowering drugs. Studies have shown that normal Lp(a) levels should be less than 300 mg/L (30 mg/dL). When Lp(a) concentrations exceed 34 mg/dL, the risk of coronary artery disease increases by about two times. When evaluated together with low-density lipoprotein cholesterol concentrations, the risk increases by about six times. Without considering other plasma lipoproteins, Lp(a) assessment values are considered to be the most sensitive feature of the development of coronary artery disease. Therefore, Lp(a) inhibitors are expected to become potential therapeutic targets for the treatment and prevention of cardiovascular and cerebrovascular diseases and their complications by reducing the concentration of Lp(a) in the blood. Traditional statin lipid-regulating and plaque-stabilizing drugs do not cause significant changes in Lp(a) levels, nor do they lead to clinically important differences in Lp(a) in patients at risk for CVD. In some studies, statins can even lead to elevated Lp(a). Fibrates and ezetimibe are also ineffective in lowering Lp(a). Currently, drugs found to be effective in lowering Lp(a) comprise: niacin, PCSK9 inhibitors, estrogen, mipomersen, and lomitapide. Considering the effect of lowering Lp(a), economy, clinical adverse events, clinical operability and scalability, and cardiovascular benefits, the above treatment options are not the best choice. New Lp(a)-lowering drugs - small nucleic acid drugs are expected to become effective intervention measures to lower Lp(a). Therefore, the development of an efficient inhibitor for silencing Lp(a) will provide effective cardiovascular and cerebrovascular diseases for long-term treatment, making it have better efficacy, specificity, stability, tar