Search

EP-4741503-A1 - RNAI AGENT FOR INHIBITING AGT GENE EXPRESSION AND USE THEREOF

EP4741503A1EP 4741503 A1EP4741503 A1EP 4741503A1EP-4741503-A1

Abstract

The present invention relates to a double-stranded RNAi agent targeting AGT, a pharmaceutical composition comprising same and a use thereof in preparing a drug for treating diseases associated with AGT expression, such as hypertension.

Inventors

  • DONG, Yunxia
  • SHAO, YU
  • SU, Xiaoye
  • WANG, LINGYU
  • DAN, Mo
  • ZHANG, XIAOLIN
  • LIU, YONGMEI
  • REN, Jiafeng
  • WANG, Mingxiao

Assignees

  • CSPC Zhongqi Pharmaceutical Technology (Shijiazhuang) Co., Ltd.

Dates

Publication Date
20260513
Application Date
20240705

Claims (16)

  1. A double-stranded RNAi agent, comprising a sense strand and an antisense strand, wherein nucleotide sequences of the sense strand and the antisense strand are as set forth in any one of dsRNA sequences in Table 2.
  2. The double-stranded RNAi agent according to claim 1, comprising a sense strand and an antisense strand, wherein (1) the sense strand comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 1) (5' to 3' direction) and/or the antisense strand comprises the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 2) (5' to 3' direction); (2) the sense strand comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACC (SEQ ID NO: 3) (5' to 3' direction) and/or the antisense strand comprises the nucleotide sequence GGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 4) (5' to 3' direction); or (3) the sense strand comprises the nucleotide sequence CUUCUAAUGAGUCGACUUUGA (SEQ ID NO: 5) (5' to 3' direction) and/or the antisense strand comprises the nucleotide sequence UCAAAGUCGACUCAUUAGAAGAA (SEQ ID NO: 6) (5' to 3' direction).
  3. The double-stranded RNAi agent according to claim 1 or 2, wherein the double-stranded RNAi agent comprises, on one or more nucleotides of the sense strand and the antisense strand thereof, one or more modifications selected from the group consisting of: 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxy, a locked nucleic acid modification, a ring-opened or unlocked nucleic acid modification, a DNA modification, and a fluorescent probe modification; preferably, both the sense strand and the antisense strand of the double-stranded RNAi agent contain 2'-O-methyl and/or 2'-fluoro modifications.
  4. The double-stranded RNAi agent according to claim 3, wherein the double-stranded RNAi agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage, preferably at least one phosphorothioate linkage; further preferably, the internucleotide linkage is located at 5'-terminus and 3'-terminus of the sense strand and antisense strand; and more preferably, the internucleotide linkage is located within three nucleotides at the 5'-terminus and the 3'-terminus of the sense strand and the antisense strand.
  5. The double-stranded RNAi agent according to any one of claims 1 to 4, wherein the double-stranded RNAi agent comprises: (1) the antisense strand having an overhang with a 5'(s)mN(s)mN3' structure at the 3'-terminus; (2) the antisense strand comprising a fluoro modification at least at positions 2, 14 and 16 from the 5'-terminus, and a methoxy modification at remaining positions; (3) the antisense strand comprising at least two phosphorothioate modifications from the 3'-terminus and the 5'-terminus, preferably the antisense strand comprising a phosphorothioate backbone modification in at least the first and second internucleotide linkages from the 3'-terminus and the 5'-terminus; (4) the sense strand comprising a fluoro modification at positions 7 and 9 to 11 from the 5'-terminus, and a methoxy modification at remaining positions; and (5) the sense strand comprising at least two phosphorothioate modifications from the 5'-terminus, preferably the sense strand comprising a phosphorothioate backbone modification in at least the first and second internucleotide linkages from the 5'-terminus.
  6. The double-stranded RNAi agent according to any one of claims 1 to 5, wherein the double-stranded RNAi agent is conjugated to at least one ligand selected from the group consisting of cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, and N-acetylglucosamine (GalNAc) derivatives or analogs; preferably, the ligand is N-acetylglucosamine (GalNAc) derivatives or analogs.
  7. The double-stranded RNAi agent according to claim 6, wherein the ligand is linked to the 3'-terminus, the 5'-terminus and/or internally within the strand of the double-stranded RNAi agent; preferably, the ligand is linked to the 3'-terminus of the sense strand of the double-stranded RNAi agent.
  8. A double-stranded RNAi agent comprising: (1) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 7) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm (SEQ ID NO: 8); (2) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 9) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm (SEQ ID NO: 10); (3) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsAfsAmCmCmUmGmUmCmAmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm (SEQ ID NO: 12); (4) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO: 13) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm (SEQ ID NO: 14); (5) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm (SEQ ID NO: 16); (6) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO: 17) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm (SEQ ID NO: 18); (7) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence AmsGfsAmAmGmAmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGmsGm (SEQ ID NO: 19) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm (SEQ ID NO: 20); (8) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence CmsAfsUmUmAmGmAmAmGmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO: 21) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmUmGm (SEQ ID NO: 22); (9) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO: 23) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm (SEQ ID NO: 24); (10) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO: 25) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm (SEQ ID NO: 26); or (11) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence UmsUfsUmUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO: 27) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAmAm (SEQ ID NO: 28); wherein Am, Um, Cm and Gm represent 2'-O-methyl-modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro-modified ribonucleotides A, U, C and G, respectively; and (s) represents that two adjacent nucleotides are linked via a phosphorothioate backbone.
  9. The double-stranded RNAi agent according to claim 8, wherein the double-stranded RNAi agent is conjugated to at least one ligand.
  10. The double-stranded RNAi agent according to claim 9, wherein the ligand is an N-acetylglucosamine (GalNAc) derivative or analog; preferably, the N-acetylglucosamine (GalNAc) derivative or analog is linked to the 3'-terminus of the sense strand of the double-stranded RNAi agent; more preferably, the GalNAc has a structure represented by formula II:
  11. The double-stranded RNAi agent according to any one of claims 8 to 10, comprising: (1) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 7) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm-L96 (SEQ ID NO: 29); (2) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 9) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm-L96 (SEQ ID NO: 30); (3) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsAfsAmCmCmUmGmUmCmAmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm-L96 (SEQ ID NO: 31); (4) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO: 13) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm-L96 (SEQ ID NO: 32); (5) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm-L96 (SEQ ID NO: 33); (6) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO: 17) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm-L96 (SEQ ID NO: 34); (7) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence AmsGfsAmAmGmAmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGmsGm (SEQ ID NO: 19) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm-L96 (SEQ ID NO: 35); (8) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence CmsAfsUmUmAmGmAmAmGmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO: 21) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmUmGm-L96 (SEQ ID NO: 36); (9) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO: 23) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm-L96 (SEQ ID NO: 37); (10) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO: 25) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm-L96 (SEQ ID NO: 38); or (11) an antisense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence UmsUfsUmUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO: 27) and a sense strand composed of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99% or 100% identity to the nucleotide sequence GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAmAm-L96 (SEQ ID NO: 39); wherein Am, Um, Cm and Gm represent 2'-O-methyl-modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro-modified ribonucleotides A, U, C and G, respectively; and (s) represents that two adjacent nucleotides are linked via a phosphorothioate backbone, and L96 is linked to the 3'-terminus of the sense strand of the double-stranded RNAi agent and has a structural formula represented by formula III:
  12. The double-stranded RNAi agent according to claim 11, wherein the double-stranded RNAi agent has a structure represented by formula IV:
  13. A reagent or kit comprising the double-stranded RNAi agent according to any one of claims 1 to 12 or the DNA molecule according to claim 12.
  14. A pharmaceutical composition comprising the double-stranded RNAi agent according to any one of claims 1 to 12.
  15. Use of the double-stranded RNAi agent according to any one of claims 1 to 12 or the pharmaceutical composition according to claim 15 in preparation of a medicament for preventing and/or treating a disease mediated by AGT expression or alleviating symptoms of a disease mediated by an AGT gene.
  16. The use according to claim 15, wherein the disease mediated by the AGT gene comprises hypertension, borderline hypertension, primary hypertension, secondary hypertension, hypertensive emergency, hypertensive urgency, isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiac myopathy, glomerulosclerosis, coarctation of the aorta, aortic aneurism, ventricular fibrosis, Cushing's syndrome, and other glucocorticoid excess states including chronic steroid therapy, pheochromocytoma, reninoma, secondary aldosteronism and other mineralocorticoid excess states, sleep apnea, thyroid/parathyroid disease, heart failure, myocardial infarction, angina, stroke, diabetes mellitus, renal disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), and fetal growth restriction.

Description

CROSS-REFERENCE TO RELATED APPLICATION The present application claims the priorities of Chinese Patent Application No. 202310826984.8 entitled with "RNAI AGENT FOR INHIBITING AGT GENE EXPRESSION AND USE THEREOF" and filed with the Chinese Patent Office on July 6, 2023, and Chinese Patent Application No. 202410478014.8 entitled with "RNAI AGENT FOR INHIBITING AGT GENE EXPRESSION AND USE THEREOF" and filed with the Chinese Patent Office on April 19, 2024, the disclosures of which are incorporated herein by reference in their entirety. TECHNICAL FIELD The present application belongs to the field of molecular biology, and relates to a modified double-stranded RNAi agent and use thereof and specifically to a double-stranded RNAi agent for inhibiting the AGT gene expression, a pharmaceutical composition thereof, and use of the double-stranded RNAi agent or the pharmaceutical composition thereof for treatment of diseases mediated by AGT expression. BACKGROUND RNA interference (RNAi) is ubiquitous across species in nature. Since the initial discovery of the RNAi phenomenon in Caenorhabditis elegans (C. elegans) by Andrew Fire, Craig Mello et al. in 1998 and the confirmation of RNAi in mammals by Tuschl, Phil Sharp et al. in 2001, a series of advances have been made in research on the mechanisms and principles, gene functions, clinical applications and the like of RNAi. RNAi plays a pivotal role in multiple organismal protection mechanisms such as defense against viral infection and suppression of transposon jumping (Hutvágner et al., 2001; Elbashir et al., 2001; Zamore 2001). Therefore, products developed based on the RNAi mechanism are highly promising drug candidates. Small interfering RNA (siRNA) could exert an RNA interference effect and is a primary tool for achieving RNAi. Hypertension, a serious cardiovascular disease, can significantly increase the risk of cardiac, neurological, renal, and other diseases and is a leading cause of premature death worldwide. Hypertension is diagnosed if the systolic blood pressure (SBP) readings are ≥140 mmHg and/or the diastolic blood pressure (DBP) readings are ≥90 mmHg on two separate dates. It is estimated that 1.28 billion adults aged 30 to 79 years worldwide suffer from hypertension. Of these, 46% of adults with hypertension are unaware of their condition, and only 42% of hypertensive patients have been diagnosed and treated, with only about one-fifth (21%) hypertensive patients have their blood pressure under control. In China, however, the latest disease survey data show that over one-quarter of residents aged 18 or above have hypertension, but the control rate stands at only 16.9%. Prevention and treatment of hypertension are highly challenging. Hypertension could cause damage to major organs such as heart, brain and kidney and is called a "silent killer". Long-term overactivity of the renin-angiotensin-aldosterone system (RAAS) pathway is considered a major factor in the pathogenesis of cardiovascular diseases, including hypertension and heart failure. While suppression of the RAAS pathway by angiotensin-converting enzyme inhibitors (ACEis) or type I angiotensin receptor blockers (ARBs), such as commonly-used Sartan or Pril antihypertensive drugs, is one of the most effective treatments of hypertension and heart failure with reduced ejection fraction, this approach has limited efficacy in preventing target organ damage and cardiovascular death, and meanwhile carries a higher risk of targeting toxicity, primarily manifested as hyperkalemia and renal insufficiency. Consequently, these drugs can only be taken at lower clinical doses, which restrict their more effective inhibitory effects on these pathways and their clinical benefits. Furthermore, suppression of downstream signaling in the RAAS pathway may induce compensatory activation of upstream pathways, thereby limiting its therapeutic efficacy. In rodents and humans, angiotensin (1-12) has been identified as a non-renin-dependent substrate for angiotensin II generation. In view of this, a team of researchers from the United States has designed a monoclonal antibody directed against the C-terminus of the human angiotensin (1-12) sequence. The researchers employed a hypertensive model expressing the human angiotensinogen (AGT) gene in the rat genome to investigate the efficacy of immunoneutralization of the endogenous human angiotensin (1-12) in controlling the elevated blood pressure and reversing hypertension-induced target organ damage. They concluded that angiotensin (1-12) is an endogenous substrate for angiotensin II generation and contributes to the regulation of the arterial pressure in the humanized hypertensive model, and that selective immunoneutralization of this alternative substrate is a promising, novel therapeutic approach for treating hypertension and preventing its adverse cardiovascular sequelae. Targeting the upstream of the RAAS pathway by silencing the hepatic AGT is a novel mechanism for RAAS