KR-102962768-B1 - Nano-bioreactor for formic acid production using dual enzyme cage and method for producing formic acid therethrough

Abstract

The present invention relates to a nano bioreactor for formic acid production using a dual-enzyme cage and a method for producing salt through the same. The nano bioreactor according to the present invention can continuously produce formic acid with a high yield by including carbon monoxide dehydrogenase (CODH) and formate dehydrogenase (FDH).

Inventors

• 오병근
• 이진원
• 나정걸
• 김태환
• 김영중
• 윤지웅

Assignees

• 서강대학교산학협력단

Dates

Publication Date

20260512

Application Date

20220323

Claims (12)

1. Carbon monoxide dehydrogenase (CODH); Formate dehydrogenase (FDH) that reduces carbon dioxide produced from the above carbon monoxide dehydrogenase; A structure surrounding the carbon monoxide dehydrogenase and the formate dehydrogenase, comprising a hollow interior and one or more pores; and An electron carrier disposed within the above structure; A nano bioreactor for formic acid production comprising
2. In paragraph 1, the above structure is, A nano bioreactor for formic acid production comprising a zeolite imidazolate (ZIF) structure.
3. A nano bioreactor for formic acid production, wherein, in paragraph 2, the zeolite imidazolate-based structure is ZIF-8.
4. A nano bioreactor for formic acid production according to claim 1, wherein the bioreactor further comprises magnetic nanoparticles.
5. A nano bioreactor for producing formic acid, wherein the carbon monoxide dehydrogenase in claim 1 is encoded from a polynucleotide comprising a salt sequence represented by one selected from the group consisting of SEQ ID NOs 1 to 20.
6. A nano bioreactor for producing formic acid according to claim 1, wherein the formic acid dehydrogenase comprises the amino acid sequence of SEQ ID NOs 21 to 22.
7. A nano bioreactor for formic acid production according to claim 1, wherein the electron carrier is a protein tagged with viologen.
8. A method for producing formic acid including the following steps: The method comprises a reaction step of contacting a nano bioreactor containing carbon monoxide dehydrogenase (CODH) and formate dehydrogenase (FDH) with water and carbon monoxide gas, and The above nano bioreactor is, A structure surrounding the carbon monoxide dehydrogenase and the formate dehydrogenase, comprising a hollow interior and one or more pores; and It includes an electron carrier disposed within the above structure.
9. In paragraph 8, the above structure is, A method for producing formic acid comprising a zeolite imidazolate (ZIF) structure.
10. A method for producing formic acid according to claim 9, wherein the zeolite imidazolate-based structure is ZIF-8.
11. A method for producing formic acid according to claim 8, wherein the bioreactor further comprises magnetic nanoparticles.
12. A method for producing formic acid according to claim 8, wherein the electron carrier is a protein tagged with viologen.

Description

Nano-bioreactor for formic acid production using dual enzyme cage and method for producing formic acid therethrough The present invention relates to a nano bioreactor for producing formic acid using a dual-enzyme cage and a method for producing salt through the same. The present invention relates to a nano bioreactor for continuously producing formic acid with high yield using a dual enzyme cage comprising carbon monoxide dehydrogenase (CODH) and formate dehydrogenase (FDH), and a method for producing formic acid through the same. Carbon monoxide is a compound composed of one carbon atom and one oxygen atom. It is a colorless, odorless, flammable gas characterized by a density slightly lower than that of air. Carbon monoxide is used in the production of many compounds, ranging from drugs and fragrances to fuels, and is also known to be produced by many organisms, including humans. However, when released into the atmosphere, carbon monoxide functions as a greenhouse gas and is known to potentially influence climate change. In mammals, low concentrations act as endogenous neurotransmitters, while high concentrations are known to cause poisoning. Meanwhile, although carbon monoxide is highly valuable as a carbon substrate due to its large content in shale gas and byproduct gases, it is difficult to handle and poses challenges in processes for producing useful substances due to toxicity and environmental pollution issues. Formic acid has traditionally been used in the synthesis of organic reagents and solvents, as well as in dyeing and tanning. Recently, research on manufacturing batteries using formic acid has been underway, and in the field of bioprocessing, formic acid is attracting attention in terms of process configuration and usability because it can be utilized as a substrate by various microorganisms. Against this backdrop, research on substances that produce formic acid from the toxic substance carbon monoxide and methods utilizing them has been continuously conducted, but there have been no significant results to date. FIG. 1 is a schematic diagram showing a bioreaction process according to one embodiment of the present invention. FIG. 2 is a diagram showing a formic acid production process according to one embodiment of the present invention. FIG. 3 is a diagram showing a nano bioreactor according to one embodiment of the present invention. Figure 4 is a graph showing the results of producing formic acid according to one embodiment of the present invention. The present invention will be explained in more detail below through the following examples. However, these examples are merely illustrative of the invention, and the scope of the invention is not limited by these examples. Example 1: Preparation of a double enzyme cage 1-1. Carbon monoxide dehydrogenase (CODH) Carbon monoxide dehydrogenases were provided by the Ulsan National Institute of Science and Technology (UNIST) and used in the following experiments. A total of 20 types of carbon monoxide dehydrogenases were provided, and the gene sequences encoding each carbon monoxide dehydrogenase are shown in Tables 1 to 20 below. Sequence numberdesignationSequence (5'->3')note1chCODH-1atggcgaaacaaaatctgaagagcaccgaccgtgcggttcaacaaatgctggataaagcgaagcgtgagggtattcaaaccgtgtgggatcgttacgaggcgatgaagccgcagtgcgg tttcggcgaaaccggtctgtgctgccgtcactgcctgcaaggtccgtgccgtattaacccgtttggcgatgagccgaaagtgggcatttgcggtgcgaccgcggaagtgatcgttgcgc gtggtctggaccgtagcattgcggcgggtgcggcgggtcatagcggtcatgcgaagcacctggcgcacaccctgaagaaagcggtgcagggcaaagcggcgagctatatgattaaggac cgtaccaaactgcacagcatcgcgaagcgtctgggtattccgaccgaaggccaaaaagacgaggatattgcgctggaagttgcgaaagcggcgctggcggacttccatgagaaagatacc ccggttctgtgggtgaccaccgttctgccgccgagccgtgtgaaggttctgagcgcgcatggtctgatcccggcgggtatgatcacgaaatcgcggagattatgcaccgtaccagcat gggttgcgacgcggatgcgcagaacctgctgctgggtggcctgcgttgcagcctggcggacctggcgggttgctacatgggcaccgacctggcggatatcctgtttggtaccccggcgcc ggtggttaccgaaagcaacctgggcgtgctgaaggcggatgcggtgaacgttgcggtgcacggtcacaacccggttctgagcgacatcattgttagcgtgagcaaagagatggaaaacg aggcgcgtgcggcgggtgcgaccggtatcaacgtggttggtatttgctgcaccggcaacgaggtgctgatgcgtcacggtattccggcgtgcacccacagcgttagccaggaaatggcga tgatcaccggcgcgctggacgcgatgatcctggattatcagtgcattcaaccgagcgtggcgaccattgcggagtgcaccggtaccaccgttattaccaccatggaaatgagcaaaatc accggtgcgacccatgtgaactttgcggaggaagcggcggttgagaacgcgaagcaaatcctgcgtctggcgattgatacctttaaacgtcgtaagggtaaaccggtggagatcccgaac attaagaccaaagtggttgcgggcttcagcaccgaagcgatcattaacgcgctgagcaagctgaacgcgaacgatccgctgaaaccgctgattgacaacgtggttaacggtaacatccg tggcgtgtgcctgttcgcgggttgcaacaacgttaaggtgccgcaggaccaaaactttaccaccattgcgcgtaagctgctgaaacagaacgttctggtggttgcgaccggttgcggtgc gggtgcgctgatgcgtcacggttttatggacccggcgaacgtggatgagctgtgcggcgacggtctgaaagcggttctgaccgcgatcggtgaagcgaacggtctgggtggcccgctgc cgccggtgctgcacatgggtagctgcgttgacaacagccgtgcggtggcgctggttgcggcgctggcgaaccgtctgggcgttgacctggatcgtctgccggtggttgcgagcgcggcgg aatggatgcatgagaaggcggtggcgattggtacctgggcggttaccatcggtctgccgacccacattggtgtgctgccgccgatcaccggcagcctgccggtgacccaaatcct