KR-20260062179-A - A novel Saccharomyces cerevisiae strain and a cosmetic composition for improving skin condition or reducing hair loss comprising a fermented product thereof
Abstract
The present invention relates to a cosmetic composition for improving skin condition or hair loss, comprising a novel Saccharomyces cerevisiae strain and a fermented product thereof, wherein the cosmetic composition according to the present invention has significantly excellent effects for improving skin condition and hair loss.
Inventors
- 배수정
- 최수련
- 권순우
- 김진화
Assignees
- 주식회사 잇츠한불
Dates
- Publication Date
- 20260507
- Application Date
- 20241025
Claims (20)
- Saccharomyces cerevisiae HBWKY-1 strain deposited under accession number KCTC 15765BP.
- Claim 1, wherein the strain is a strain having the 16S rRNA nucleotide sequence of SEQ ID NO. 1.
- A cosmetic composition for improving skin condition or hair loss comprising a fermented product of the Saccharomyces cerevisiae HBWKY-1 strain deposited under accession number KCTC 15765BP.
- A cosmetic composition according to claim 3, wherein the fermented product is obtained by inoculating and culturing the Saccharomyces cerevisiae HBWKY-1 strain in a medium containing a plant malt saccharification liquid.
- A cosmetic composition according to claim 4, wherein the plant is one or more selected from the group consisting of Polygonum multiflorum, prune, fig, scutellaria root, sprouted black rice, bloodroot, black bean, trumpet vine, snow lotus, rowan, pollen, water hyacinth, juniper, rhododendron, bleeding heart, mistletoe, sedum, goldenrod, Phellinus linteus, tomato, broccoli, cabbage, Houttuynia cordata, dried tangerine peel, peony, chestnut flower, burdock, kudzu, walnut, corn, watercress, mugwort, Chinese toon, Khorasan wheat, and Aralia elata.
- A cosmetic composition according to claim 3, wherein the improvement of the skin condition is improvement of skin damage caused by active oxygen, anti-inflammation, skin moisturization, improvement of skin wrinkles, improvement of acne, improvement of sebum, improvement of skin exfoliation, or improvement of skin elasticity.
- A cosmetic composition for improving skin condition or hair loss, comprising a complex fermented product of the Saccharomyces cerevisiae HBWKY-1 strain and the Lactobacillus pentosus strain deposited under accession number KCTC 15765BP.
- A cosmetic composition according to claim 7, wherein the complex fermented product is obtained by inoculating and culturing the Saccharomyces cerevisiae HBWKY-1 strain and the Lactobacillus pentosus strain in a medium containing a plant malt saccharification liquid.
- A cosmetic composition according to claim 7, wherein the Lactobacillus pentosus strain is the Lactobacillus pentosus HB-8023 strain deposited under accession number KCTC 13322BP.
- A cosmetic composition according to claim 8, wherein the plant is one or more selected from the group consisting of Polygonum multiflorum, prune, fig, scutellaria root, sprouted black rice, bloodroot, black bean, trumpet vine, snow lotus, rowan, pollen, water hyacinth, juniper, rhododendron, bleeding heart, mistletoe, sedum, goldenrod, Phellinus linteus, tomato, broccoli, cabbage, Houttuynia cordata, dried tangerine peel, peony, chestnut flower, burdock, kudzu, walnut, corn, watercress, mugwort, Chinese toon, Khorasan wheat, and Aralia elata.
- A cosmetic composition according to claim 7, wherein the improvement of the skin condition is improvement of skin damage caused by active oxygen, anti-inflammation, skin moisturization, improvement of skin wrinkles, improvement of acne, improvement of sebum, improvement of skin exfoliation, or improvement of skin elasticity.
- (a) A step of preparing a malt saccharification liquid of plants by mixing plants with malt; (b) a step of inoculating and culturing the Saccharomyces cerevisiae HBWKY-1 strain in a medium containing plant malt saccharification liquid; and (c) A method for preparing a fermented product of the Saccharomyces cerevisiae HBWKY-1 strain, comprising the step of removing the cells from the cultured product.
- A method of manufacturing according to claim 12, wherein in step (a), the plant and the malt are mixed in a weight ratio of 1:0.1 to 10.
- A manufacturing method according to claim 12, wherein step (a) is performed at 0 to 100 ℃.
- A manufacturing method according to claim 12, wherein step (a) is performed for 0.5 to 48 hours.
- A method of manufacturing according to claim 12, wherein the plant is one or more selected from the group consisting of Polygonum multiflorum, prune, fig, scutellaria root, sprouted black rice, bloodroot, black bean, trumpet vine, snow lotus, rowan, pollen, water hyacinth, juniper, rhododendron, bleeding heart, mistletoe, sedum, goldenrod, Phellinus linteus, tomato, broccoli, cabbage, Houttuynia cordata, dried tangerine peel, peony, chestnut flower, burdock, kudzu, walnut, corn, watercress, mugwort, Chinese toon tree, Khorasan wheat, and Aralia elata.
- A method of manufacturing according to claim 12, wherein step (b) involves additionally inoculating and culturing a Lactobacillus pentosus strain.
- A manufacturing method according to claim 17, wherein step (b) is performed at 0 to 50 ℃.
- A manufacturing method according to claim 17, wherein step (b) is performed at 0 to 300 rpm.
- A method of manufacturing according to claim 17, wherein the plant is one or more selected from the group consisting of Polygonum multiflorum, prune, fig, scutellaria root, sprouted black rice, bloodroot, black bean, trumpet vine, snow lotus, rowan, pollen, water hyacinth, juniper, rhododendron, bleeding heart, mistletoe, sedum, goldenrod, Phellinus linteus, tomato, broccoli, cabbage, Houttuynia cordata, dried tangerine peel, peony, chestnut flower, burdock, kudzu, walnut, corn, watercress, mugwort, Chinese toon, Khorasan wheat, and Aralia elata.
Description
A novel Saccharomyces cerevisiae strain and a cosmetic composition for improving skin condition or reducing hair loss comprising a fermented product thereof The present invention relates to a novel Saccharomyces cerevisiae strain and a cosmetic composition for improving skin condition or hair loss, comprising a fermented product thereof. Kefir, also known as Tibetan mushroom, is a fermented milk product produced through the simultaneous fermentation of lactic acid bacteria and yeast, unlike regular yogurt. It is characterized by fermentation at temperatures of approximately 22–25°C, rather than the 32–42°C typically suitable for general culture. Instead of the liquid or cellular starter cultures commonly used for fermented products, it is cultured as a mass of kefir grains containing a mixture of lactic acid bacteria and yeast. Lactic acid bacteria are primarily distributed on the surface of the kefir grain particles, while yeast is found inside. The most significant characteristic of kefir is that, unlike yogurt which produces lactic acid, it undergoes an alcoholic fermentation process that generates small amounts of alcohol, CO2, and kefiran. Because kefir is produced using milk derived from animals as a lactose substrate, it is classified as an animal-based food. However, unlike regular kefir, water kefir is fermented using only sugars as a sucrose substrate, so it is classified as a plant-based food; furthermore, unlike milk kefir, it is characterized by its transparent appearance. In addition, water kefir can be used in vegan products. Saccharomyces cerevisiae is generally a strain derived from brewer's yeast. While there are many studies utilizing strains derived from brewer's yeast, research results on cosmetic compositions using Saccharomyces cerevisiae derived from kefir are minimal, and among them, there are no inventions regarding Saccharomyces cerevisiae derived from water kefir. Figure 1 shows the process of isolating, culturing, and identifying the Saccharomyces cerevisiae HBWKY-1 strain derived from fig water kefir. Figure 2 is a figure showing the classification of the Saccharomyces cerevisiae HBWKY-1 strain. Figure 3 shows the growth curve of the Saccharomyces cerevisiae HBWKY-1 strain over time. Figure 4 is a figure showing whether organic acids are secreted after colonies produced by culturing the Saccharomyces cerevisiae HBWKY-1 strain are plated on a medium. The present invention will be explained in more detail below through the following examples. However, these examples are merely illustrative of the invention, and the scope of the invention is not limited by these examples. Preparation Example 1. Isolation, culture, and identification of Saccharomyces strains derived from fig water kefir Grains and the liquid phase of the fermentation product were separated from fig water kefir (Fig. 1). The grains were homogenized and plated on SDA, TSA, and MRS agar to collect colonies. Morphological yeast strains were identified from the collected colonies, and the identified strains were analyzed using PCR with 18S primers. The 18S rRNA sequence of the finally selected HBWKY-1 is as shown in Sequence No. 1. Since the isolated strain was genetically similar to Saccharomyces cerevisiae with 99% sequence homology, final classification was performed through biochemical experiments (Fig. 2 and Table 1). Specifically, an inoculum of Saccharomyces cerevisiae HBWKY-1 was prepared. Solid-cultured colonies were suspended in suspension medium, adjusted to a turbidity of 2 McFarland, and the bacterial solution was dispensed onto the strip without forming air bubbles. The tray lid was covered, and after incubation at 30°C for 48 to 72 hours, the turbidity was evaluated. The results were indicated as shown in Table 1 below. The evaluated results were entered into a program and classified as Saccharomyces cerevisiae. Accordingly, this strain was named Saccharomyces cerevisiae HBWKY-1 and deposited with the National Center for Biological Resources on January 10, 2024, under accession number KCTC 15765BP. [Sequence No. 1] GCTCATTAAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACATGGTATAACTGTGGTAATTCTAGAGCTAATACATGCTTAAAATCTCGACCCTTTGGAAGAGATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGTGCTGGCGATGGTTCATTCAAA TTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTAATTCAGGGAGGTAGTGACAATAAATAACGATACAGGGCCCATTCGGGTCTTGTAAT TGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGGTTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCTTCTGGCTAACCTTGA GTCCTTGTGGCTCTTGGCGAACCGGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAATATATTAGCATGGAATAATAGAATAGGACGTTTGGTTCTATTTTGTTGGTTTCTAGGACCATCGTAATGATTAATAGGGACGGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTA TTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGACGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGATGA