KR-20260067507-A - Compositions Comprising CaP Nanoparticle For Ganoderma lucidum Gene Editing
Abstract
The present invention relates to a composition for reishi mushroom gene editing comprising CaP nanoparticles, Cas9 protein, and guide RNA, a method for preparing the same, and a method for reishi mushroom gene editing using the same. The present invention can correct specific genes of Reishi mushrooms without the insertion of foreign genes and has superior correction efficiency compared to existing gene editing technologies, making it useful as a tool for breeding Reishi mushrooms, strengthening specific functional genes, and improving productivity.
Inventors
- 김민식
- 오연이
- 오민지
- 임지훈
- 이은지
Assignees
- 대한민국(농촌진흥청장)
Dates
- Publication Date
- 20260513
- Application Date
- 20241105
Claims (17)
- A composition for reishi mushroom gene editing comprising CaP nanoparticles, Cas9 protein, and guide RNA.
- In paragraph 1, A composition for reishi mushroom gene editing in which the above Cas9 protein and guide RNA form a complex with CaP nanoparticles.
- In paragraph 1, The above composition is one in which the CaP nanoparticles are prepared by adding PAA (Polyacrylic Acid) to sodium disodium phosphate ( Na₂HPO₄ ) and calcium chloride ( CaCl₂ ).
- In paragraph 1, A composition in which the guide RNA is composed of the nucleotide sequence of SEQ ID NO. 3 or SEQ ID NO. 6.
- In paragraph 1, A composition in which the above Cas9 protein and guide RNA are mixed in a molar ratio of 1:2.
- In paragraph 1, A composition in which the above gene is the catA(Catechol-1,2 Dehydrogenase) gene.
- (a) a step of mixing Cas9 protein, guide RNA, and buffer solution; and (b) A method for preparing a composition for gene editing of Reishi mushrooms, comprising the step of forming a complex of the above Cas9 protein and guide RNA with CaP nanoparticles.
- In Paragraph 7, A method of preparation in which the guide RNA of step (a) above consists of the nucleotide sequence of SEQ ID NO. 3 or SEQ ID NO. 6.
- In Paragraph 7, A method for manufacturing in which the buffer solution of step (a) above contains 0.1 to 0.3 M of sorbitol.
- In Paragraph 7, A method for manufacturing in which the pH of the buffer solution in step (a) above is 6.0 to 7.5.
- In Paragraph 7, Step (b) above involves adding sodium disodium phosphate ( Na₂HPO₄ ), calcium chloride ( CaCl₂ ) , and PAA to the mixture of Step (a), A method for manufacturing, comprising the step of manufacturing a CaP nanoparticle/RNPs complex containing Cas9 protein and guide RNA.
- A method for gene editing of a Reishi mushroom comprising the composition for gene editing of a Reishi mushroom according to claim 1 and the step of treating a Reishi mushroom protoplast with polyethylene glycol (PEG).
- In Paragraph 12, A correction method in which the gene correction composition of the above-mentioned Reishi mushroom and the Reishi mushroom protoplast are mixed in a volume ratio of 1:5 to 15.
- In Paragraph 12, A correction method in which the above gene is the catA(Catechol-1,2 Dehydrogenase) gene.
- A Reishi mushroom mutant produced by the Reishi mushroom gene editing method of Article 12.
- In paragraph 15, The above gene is a Reishi mushroom mutant in which the gene is the catA(Catechol-1,2 Dehydrogenase) gene.
- A Reishi mushroom gene editing kit comprising the gene editing composition of claim 1.
Description
Compositions Comprising CaP Nanoparticles for Ganoderma lucidum Gene Editing The present invention relates to a composition for reishi mushroom gene editing comprising CaP nanoparticles, Cas9 protein, and guide RNA, a method for preparing the same, and a method for reishi mushroom gene editing using the same. In the fields of life science and agriculture, gene editing technology is utilized as an important tool for treating genetic diseases or improving agricultural productivity. Conventional gene editing has primarily been carried out by inserting exogenous DNA, such as plasmids or DNA fragments, into cells to induce the correction of specific genes. However, this method has limitations in its application to edible crops, particularly edible fungi such as mushrooms, due to low gene editing efficiency and the occurrence of exogenous gene insertion. Recently, methods capable of correcting specific genes without introducing foreign genes are being researched. In particular, the CRISPR/Cas9 system is being utilized as a tool for gene editing because it can induce precise and rapid gene modifications without foreign genes. However, there have been difficulties in obtaining gene-edited specimens due to the still low efficiency of gene editing. Meanwhile, the mushroom industry has been mainly limited to edible and medicinal mushrooms, among which Ganoderma lucidum is known as an important medicinal mushroom that produces ganoderic acid, a representative functional substance. Given the high industrial value of ganoderic acid, there is a growing need for gene editing technology to increase the productivity of Ganoderma lucidum; however, existing gene editing technology has limitations in that it is difficult to apply to mushrooms with dikaryotic characteristics. To overcome these limitations, there is a growing need for technology that can effectively secure genetically modified Reishi mushrooms without the insertion of foreign genes. Figure 1 shows the nuclease activity of RNPs according to the type of guide RNA, confirmed by gel electrophoresis through an in vitro cleavage assay. Figure 2 confirms the formation process of the CaP nanoparticle and RNPs complex of the present invention and the nuclease activity of the formed complex. Figure 3 shows the results of the analysis of the nucleotide sequences of genetically edited Reishi mushrooms using the CaP nanoparticle and RNPs complex of the present invention (A: gcatA-3, B: gcatA-6). The present invention will be explained in more detail below through the following examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples. Example 1. Formation of CaP nanoparticle and RNPs complex 1.1. Guide RNA Screening To select RNPs that exhibit nuclease activity specific to Reishi mushrooms, the nuclease activity of eight guide RNAs (gcatA-1 to gcatA-8) included in the RNPs was confirmed using an in vitro cleavage assay. The specific sequences of the guide RNAs used are shown in Table 1 below. First, purified Cas9 protein and guide RNA were mixed in a molar ratio of 1:2 and reacted at 37°C for 30 minutes to obtain RNPs for each guide RNA. 20 μL and 10 μL of the PCR product of the catA (Catechol-1,2 dehydrogenase) gene and the above RNPs were mixed, respectively, and reacted at 25°C for 1 hour. The mixture was then loaded onto a 1% agarose gel for electrophoresis, and the bands were observed. nucleotide sequence(5'-3')Sequence numbergcatA-1TCGTGGACAATCCCCTATCGTGG1gcatA-2CGATACGCCAAGTCGGCGAGGGG2gcatA-3ATCGACACTTGGCAAGCGGACGG3gcatA-4TTCTTCAGTTGGACCCTCCGCGG4gcatA-5GAGCTCCTGACGATCCGTCCGGG5gcatA-6ACCCCTCCGACAATGCGCGCAGG6gcatA-7CGCTCGAAGAGTCCAAGAACGGG7gcatA-8CAAGAAGCTGTTGGAGCAAGGGG8 As a result, as shown in Figure 1, bands were observed in a total of three guide RNAs (gcatA-3, gcatA-4, gcatA-6), confirming that gcatA-3, gcatA-4, and gcatA-6 specifically recognize the Ganoderma catA gene, and that RNPs containing them specifically exhibit nuclease activity. In other words, it was confirmed that gene editing is possible using three RNPs formed by guide RNAs (gcatA-3, gcatA-4, gcatA-6). 1.2. Formation of CaP Nanoparticle and RNPs Complexes To form a complex of CaP (calcium phosphate) nanoparticles and RNPs for gene editing of the Reishi mushroom of the present invention, first, purified Cas9 protein and the guide RNA selected in Example 1.1 were mixed in a molar ratio of 1:2 and reacted at 37°C for 30 minutes to form RNPs. Next, 183 μL of RNP buffer (20 mM Tris-HCl, 300 mM NaCl, pH=7.5) was added to 50 μL of RNPs (1 mg/mL) and vortexed. Subsequently, to prepare CaP nanoparticles, 10.4 μL of 60 mM sodium disodium phosphate ( Na₂HPO₄ ) was added and vortexed, 25 μL of 100 mM calcium chloride ( CaCl₂ ) was added to form calcium phosphate, and the solution containing these was incubated at room temperature for 5 minutes. Finally, CaP nanoparticles were prepared by vortexing with the addition of 5 μL of 1 M Poly