KR-20260068033-A - A microorganism of Corynebacterium genus having enhanced L-arginine productivity and a method for producing L-arginine using the same

Abstract

The present invention relates to a microorganism of the genus Corynebacterium with improved L-arginine production capacity and a method for producing L-arginine using the same. The microorganism of the genus Corynebacterium has an argO gene encoding an arginine extransporter introduced, thereby improving the L-arginine production yield compared to the parent strain and enabling effective production of L-arginine.

Inventors

• 유 미
• 이동석
• 강동훈
• 박성군
• 이신원
• 윤선준
• 이재훈

Assignees

• 대상 주식회사

Dates

Publication Date

20260513

Application Date

20260424

Claims (3)

1. A mutant strain of Corynebacterium glutamicum , which has L-arginine production ability, in which a gene involved in the excretion of lysine and arginine is disrupted and a gene encoding an arginine extransporter derived from a microorganism of the genus Escherichia is introduced at that location, thereby enhancing L-arginine production ability.
2. In claim 1, The above arginine extransporter is a mutant strain comprising the amino acid sequence of SEQ ID NO. 1.
3. The step of culturing the mutant strain of claim 1 in a medium; and A method for producing L-arginine comprising the step of recovering L-arginine from the above mutant strain or a medium in which the mutant strain is cultured.

Description

A microorganism of the genus Corynebacterium having enhanced L-arginine production capacity and a method for producing L-arginine using the same The present invention relates to a microorganism of the genus Corynebacterium with enhanced L-arginine production capacity and a method for producing L-arginine using the same. Arginine is known to be present in a free state in plants and other organisms. Although arginine is a non-essential amino acid, it is a semi-essential amino acid that must be supplied in growing children and in specific conditions such as stress, trauma, or cancer. It is widely used as an ingredient in amino acid fortifiers, pharmaceuticals, and foods. In pharmaceuticals, it is used as a liver function enhancer, brain function enhancer, male infertility treatment, and comprehensive amino acid preparation. In food, it is used as an additive in fish pastes, health drinks, and as a salt substitute for patients with hypertension. Arginine production can be achieved using wild-type strains obtained from nature or mutant strains modified to enhance their arginine production capacity. Recently, genetic recombination technology is being utilized on microorganisms such as Escherichia coli and Corynebacterium to improve arginine production efficiency. The biosynthesis of L-arginine in microorganisms is carried out starting from L-glutamate through N-acetylglutamate, N-acetylglutamyl-P, N-acetylglutamate 5-semialdehyde, N-acetylornithine, L-ornithine, L-citrulline, and argininosuccinate, and various proteins, such as enzymes, transcription factors, and transport proteins, are involved in this stepwise synthesis process. Therefore, there have been attempts to increase the production of L-arginine by inducing mutations in regulatory sequences, such as various genes involved in the L-arginine biosynthetic pathway or promoters that regulate their expression, through genetic recombination technology. According to the literature [Bellmann et al., Microbiology 2001; 147: 1765-74], lysine exporters are involved in the excretion of not only lysine but also arginine, citrulline, and ornithine, and enhancing the expression of the lysE gene, which encodes lysine exporters, increased arginine excretion capacity. However, enhancing the lysE gene also increased the excretion of byproducts other than arginine, and in particular, the increased production of ornithine, which is a byproduct, had a negative impact on arginine production. Therefore, much research is still needed to develop recombinant strains or mutants with excellent L-arginine production capabilities while reducing byproduct production. The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description. Example 1. Preparation of a strain with the argO gene introduced To introduce the argO gene, which encodes an arginine extransporter derived from microorganisms of the genus Escherichia, into an arginine-producing strain derived from Corynebacterium glutamicum, L-arginine-producing strains Corynebacterium glutamicum 14GR (KCCM13219P) and E. coli DH5a (HIT Competent cells™, Cat No. RH618) were used. The above Corynebacterium glutamicum 14GR was cultured at a temperature of 30°C in an ARG-broth medium (pH 7.2 ) composed of 10.5 g of 98% Glucose, 1 g of Beef extract, 4 g of Yeast extract, 2 g of Polypeptone, 2 g of NaCl, and 40 g of (NH₄) ₂SO₄ in 1 L of distilled water. The above E. coli DH5a was cultured at a temperature of 37°C on LB medium composed of 10.0 g of tryptone, 10.0 g of NaCl, and 5.0 g of yeast extract in 1 L of distilled water. The antibiotic kanamycin used was a product from Sigma. DNA sequencing analysis and gene synthesis were commissioned to Macrogen Co., Ltd. 1-1. Recombinant Vector A recombinant vector was constructed to disrupt the lysE gene, which is involved in the release of lysine and arginine from Corynebacterium glutamicum 14GR, and to introduce the argO gene, which encodes an arginine extransporter derived from microorganisms of the genus Escherichia, into that location. The codon-optimized argO sequence (Sequence No. 2) and the right-arm sequence used for cloning were obtained through gene synthesis. On the Corynebacterium glutamicum genome, the 655 bp left-arm and 636 bp right-arm regions centered around the lysE gene, along with the argO gene linked to the promoter, were amplified by PCR. After ligation using the overlap PCR method, they were cloned into the pk19mobsacB (ATCC, 87098) vector. To construct the above plasmid, the primers listed in Table 1 below were used to amplify each gene fragment. Primer namePrimer (5'-3')Sequence numberlysE left superior arthralgia Amplification PrimerLF1tgattacgcccggatccagatactcctttgga3LF2cggatccagatactcctttgga4LR1ttttggaatcggtggccttc5LR2ttttcgcgggttttggaatc6Promoter Amplification PrimerP-F1cccgcgaaaatggcgggtattttcatcc7P-F2t