Search

US-12616657-B2 - Cell-targeted nanoparticles to inhibit RNA cargo

US12616657B2US 12616657 B2US12616657 B2US 12616657B2US-12616657-B2

Abstract

Compositions and methods are provided for modifying the contents of exosomes released by target cells. In one embodiment cell targeted nanoparticles are used to deliver interference RNAs to the target cells which alter the packaging of exosomes released by the target cells.

Inventors

  • Chandan K. Sen
  • Subhadip GHATAK
  • Sashwati Roy

Assignees

  • THE TRUSTEES OF INDIANA UNIVERSITY

Dates

Publication Date
20260505
Application Date
20210226

Claims (20)

  1. 1 . A method of modifying the content of extracellular vesicles produced by a target cell, said method comprising transfecting said target cell with an interference RNA that impacts packaging of miRNAs into extracellular vesicles produced by said target cell, wherein the interference RNA is an oligonucleotide at least 8 nucleotides in length that is identical in sequence to a continuous 8 nucleotide sequence selected from the group consisting of GUUCAGAGUUCUAGGAGUCUU UU (SEQ ID NO: 3′), CACUCCUAGAACUCUGAACUU UU (SEQ ID NO: 4); GGAUCUGAUGGAUACGGAA (SEQ ID NO: 6), GGGAUGGCUAUAAUGGGUA (SEQ ID NO: 7), ACCGAUAGGCAGUCUGGAA (SEQ ID NO: 8) GGUGGAAJUAAGGAAGAUA (SEQ ID NO: 9) and complements thereof of said sequences.
  2. 2 . The method of claim 1 wherein the extracellular vesicle is an exosome, and the interference RNA reduces miR-126 or miR-21 packaged into exosomes released by the target cells relative to exosomes released by the target cell in the absence of said interference RNA.
  3. 3 . The method of claim 2 wherein the interference RNA comprises a continuous sequence of at least 8 nucleotides of CACUCCUAGAACUCUGAACUUUU (SEQ ID NO: 4) or a complement thereof.
  4. 4 . The method of claim 3 wherein said oligonucleotide comprises a locked nucleic acid at the N-terminus and/or the C-terminus of said oligonucleotide.
  5. 5 . The method of claim 1 wherein the target cells are transfected in vivo.
  6. 6 . The method of claim 5 wherein the target cell is transfected via the administration of targeted nanolipid particles (TNLP).
  7. 7 . The method of claim 6 wherein the TNLP comprises a lipid membrane formed as a sphere that defines an interior space and an exterior surface; a targeting moiety attached to the exterior surface; and an interference RNA located within said interior space, wherein said targeting moiety enhances uptake of the TNLP by a target cell.
  8. 8 . The method of claim 7 wherein the targeting ligand is a peptide comprising the amino acid sequence of ASKAIQFLLAG (SEQ ID NO: 1) or ASKAIQVFLLAG (SEQ ID NO: 5).
  9. 9 . The method of claim 5 wherein the target cell is transfected with an interference oligonucleotide by skin electroporation or tissue nanotransfection of the target cell.
  10. 10 . A lipid nanoparticle comprising a lipid membrane formed as a sphere that defines an interior space and an exterior surface; a targeting moiety attached to the exterior surface; and an interference RNA encapsulated within said interior space, said interference RNA comprising at least 8 nucleotides that is identical to a continuous 8 nucleotide sequence selected from the group consisting of GUUCAGAGUUCUAGGAGUCUUUU (SEQ ID NO: 3), CACUCCUAGAACUCUGAACUUUU (SEQ ID NO: 4); GGAUCUGAUGGAUACGGAA (SEQ ID NO: 6), GGGAUGGCUAUAAUGGGUA (SEQ ID NO: 7), ACCGAUAGGCAGUCUGGAA (SEQ ID NO: 8) GGUGGAAUUAAGGAAGAUA (SEO ID NO: 9) and complements thereof of said sequences wherein said targeting moiety enhances uptake of the TNLP by a target cell and said interference RNA is an inhibitor of miRNA packaging within an extracellular vesicle released by said target cell.
  11. 11 . The lipid nanoparticle of claim 10 wherein the targeting ligand comprises a peptide comprising the amino acid sequence of ASKAIQFLLAG (SEQ ID NO: 1) or ASKAIQVFLLAG (SEQ ID NO: 5).
  12. 12 . The lipid nanoparticle of claim 10 wherein said nanoparticle is a lyophilized lipid nanoparticle.
  13. 13 . A pharmaceutical composition comprising a lipid nanoparticle of claim 10 and a pharmaceutically acceptable carrier.
  14. 14 . A method of inhibiting miRNA packaging within an exosome of a target cell, the method comprising the step of administering an effective amount of a pharmaceutical composition of claim 13 to a patient.
  15. 15 . A method of treating a skin condition, the method comprising the step of administering an effective amount of a pharmaceutical composition of claim 13 to a patient in need thereof.
  16. 16 . The according to claim 15 , where the skin condition is selected from the group consisting of a burn, a wound or an infection.
  17. 17 . A method of treating a tumor, the method comprising the step of administering an effective amount of a pharmaceutical composition of claim 13 to a patient in need thereof.
  18. 18 . The method of claim 17 wherein the administration of said pharmaceutical composition reduces functional hnRNPA2B1 in said target cells.
  19. 19 . The method of claim 17 wherein the administration of said pharmaceutical composition reduces exosomal miRNA concentrations in exosomes released by the target cells.
  20. 20 . The lipid nanoparticle of claim 10 wherein the interference RNA comprises a continuous 19 nucleotide sequence that is identical to a continuous 19 nucleotide sequence selected from a sequence of the group consisting of GUUCAGAGUUCUAGGAGUCUUUU (SEQ ID NO: 3), CACUCCUAGAACUCUGAACUUUU (SEQ ID NO: 4); GGAUCUGAUGGAUACGGAA (SEQ ID NO: 6), GGGAUGGCUAUAAUGGGUA (SEQ ID NO: 7), ACCGAUAGGCAGUCUGGAA (SEQ ID NO: 8) GGUGGAAUUAAGGAAGAUA (SEQ ID NO: 9) and complements thereof.

Description

CROSS REFERENCE TO RELATED APPLICATIONS This application is a U.S. national counterpart application of international application serial No. PCT/US2021/019891 filed Feb. 26, 2021, which claims priority to U.S. Provisional Patent Application Nos. 62/982,091 filed on Feb. 27, 2020, the disclosures of which are hereby expressly incorporated by reference in their entireties. INCORPORATION BY REFERENCES OF MATERIAL SUBMITTED ELECTRONICALLY Incorporated by reference in its entirety is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: 2 kilobytes ACII (Text) file named “334053_ST25.txt,” created on Feb. 25, 2021. BACKGROUND OF THE DISCLOSURE A new paradigm of bidirectional cell-cell communication involving exosomes has emerged as a predominant mechanism of cellular crosstalk. Cellular crosstalk via exosomes is central in normal injury and repair processes. Cell communication via exosome, although important for maintaining normal homeostasis, also carry the cargo in form of miRNA that exacerbates the pathophysiological such as in cancer. Exosomes participate in cancer progression and metastasis by transferring bioactive molecules between cancer and various cells in the local and distant microenvironments. Such intercellular cross-talk results in changes in multiple cellular and biological functions in recipient cells. Exosomes carry a distinctive repertoire of cargo such as miRNAs that are selectively packaged and released. However, global suppression of exosome release using small molecule pharmacological inhibitors often disrupts the normal homeostasis. Accordingly there is a need for a mechanism to selectively inhibit cargo packaging of exosome components such as miRNA so as to inhibit the propagation of the pathological cue without disrupting normal homeostasis. As disclosed herein a novel cell-targeted functionalized lipid nanoparticle is provided that can selectively inhibit miRNA packaging within the exosome of a particular cell type. Cells that can be targeted in accordance with one embodiment include but are not limited to keratinocyes, fibroblasts, endothelial cells and macrophages. The cell-targeted functionalized lipid nanoparticles carry a peptide that is unique to recognize a particular cell type facilitating the uptake of the nanoparticle by the target cells. The lipid nanoparticle is further functionalized with inhibitor that disrupts the packing of the cargo such as miRNA within the cell. Skin is a promising route for drug delivery offering the option to evade the first-pass effect of the liver that can prematurely metabolize drugs. The present invention is a novel delivery platform based on cell targeting lipid nanoparticles (LNPs) to facilitate cell specific (e.g. keratinocytes) delivery of nucleic acids. SUMMARY In accordance with one embodiment of the present disclosure target cells are transfected with siRNAs that alter the packaging of exosomes produced by the target cells and thus the content of exosomes produced by the target cells. In one embodiment siRNAs are delivered to the cytosol of target cells via targeted lipid nanoparticles (TLNPs) wherein the siRNAs alter the miRNA content of exosomes produced by the target cell. Therapeutic delivery of such cell targeted nanoparticles will selective inhibit cargo packaging of exosome of a specific cell type, yet will not disrupt the packaging of other exosome cargo in other cell types that are required for maintaining normal homeostasis. Any siRNA targeting the nucleic acids encoding a protein that functions to package cargo within an exosome and be used in accordance with the present disclosure. Thus, formulations comprising the TLNPs disclosed herein can be administered to patients to alter the RNA cargo of exosomes released from cells in a cell specific manner. In one embodiment the TLNPs comprise a packaging inhibitory component and a targeting moiety attached to the exterior surface of the TLNP, wherein the targeting moiety specifically interacts with the target cell to selectively induce the uptake of the nanoparticle into the cytosol of the target cell. After uptake, the packaging inhibitory components of the nanoparticle interact with cellular components and alter the packaging and content of exosomes released by the target cell. In one embodiment the packaging inhibitory components of the TLNPs comprise interference RNA and/or antisense RNA molecules, and optionally the interference RNA and/or antisense RNA molecules are held within the interior of the TLNP and are released after TLNP enters the cytosol of the target cell. In one embodiment the target cells are keratinocytes and the nanoparticle contents comprise nucleic acids including interference RNA and/or antisense RNA. In accordance with one embodiment a method of regulating the miRNA packaged in the exosomes released by a targeted cell in vivo is provided. The method comprises the steps of administering a nanopart